Колл центр ифнс: Контакт-центр ФНС России продлевает часы работы до конца 2017 года | ФНС России

Содержание

Инфраструктура контакт-центров

Устоявшаяся ассоциация с термином «call-центр» или «контакт-центр» – огромное помещение, разделенное перегородками и заполненное непрерывно разговаривающими телефонистками. Когда-то так работали все крупные информационно-справочные службы, но с развитием информационных технологий возможности обработки запросов и функциональность контакт-центров значительно расширились, а сфера их применения теперь варьируется от привычной поддержки работы секретариата до обеспечения интерактивного взаимодействия граждан с государственными службами.

Современные инфраструктурные решения для контакт-центров позволяют задействовать для приема и обработки обращений полный спектр каналов коммуникации, в том числе видео, телефонные звонки, чаты, электронную почту и социальные сети, а также обеспечивают интеграцию с информационными системами и базами данных. Сочетание этих возможностей с интеллектуальной автоматизацией обработки входящих вызовов существенно повышает эффективность процессов в компаниях, бизнес которых подразумевает постоянную коммуникацию с большим количеством респондентов.

Для чего нужен контакт-центр

Внедрение инфраструктуры контакт-центра значительно повышает эффективность обработки клиентских запросов и сокращает её стоимость. Это становится возможным за счет использования следующих методов и инструментов работы:

  • использование всех доступных каналов для приема обращений и коммуникации с внешними контрагентами, что минимизирует количество необработанных обращений;
  • автоматический выбор оптимального специалиста для обработки обращения. Выбор может основываться на информации о навыках специалиста, его занятости, территориальном расположении, а также о номере телефона или другой идентификационной информации обращающегося лица;
  • автоматизация предварительной обработки обращения: предоставление информации об услугах компании, получение информации о цели обращения, постановка в очередь с дополнительным информированием респондента в процессе ожидания;
  • организация телемаркетинговых кампаний с использованием существующей базы контактов;
  • ведение истории обращений и контроль качества обслуживания, что позволяет планировать стратегию развития персонала контакт-центра.

Кому может быть полезным решение

Применение технологий контакт-центра может стать серьёзным ресурсом повышения эффективности бизнеса, если:

  • сотрудники вашей компании регулярно общаются с внешними контрагентами и клиентами;
  • ваши клиенты жалуются, что им трудно дозвониться до нужного сотрудника;
  • вы планируете начать использовать для внешних обращений единый телефонный номер;
  • вам требуется не только принимать вызовы, но и совершать регулярные звонки определенным группам клиентов;
  • вы планируете использовать современные способы коммуникаций, привычные для нового поколения;
  • вы хотите контролировать качество дистанционного обслуживания ваших клиентов;
  • вы хотите максимально эффективно использовать трудовые ресурсы компании и сократить время ожидания для входящих вызовов;
  • вы хотите оптимизировать затраты на прием и обработку обращений.

Технологии

  • Avaya
  • Aurus
  • Cisco
  • ZOOM International
  • Teleopti
  • Nice

Вакансия Оператор call — центра ФНС России в Уфе. Работа в компании Филиал ФКУ Налог-Сервис ФНС России по ЦОД в г.Москве. ID

Мы реализуем ИТ-проекты федерального масштаба, обеспечиваем непрерывное и отказоустойчивое функционирование сервисов ФНС России и информационно-технологической инфраструктуры федеральных центров обработки данных 24/7/365.  

Миссия и ценности

Мы сопровождаем службы и сервисы, которые облегчают жизнь россиян, помогают в работе сотрудникам государственных органов, облегчают межведомственное взаимодействие. Мы решаем сложные инфраструктурные и сервисные задачи, обеспечиваем эффективный электронный документооборот, сохранность данных и обработку сведений, охраняемых законом в режиме 24/7/365.  

Карьера

Масштабные проекты федерального уровня, работа с современным, передовым оборудованием и highload-системами, возможность проходить обучение от ведущих вендоров, ежедневное взаимодействие с высококлассными специалистами — все это создает условия для карьерного и профессионального развития наших сотрудников.  

Подбор сотрудников

Наши двери всегда открыты для целеустремленных людей, которые хотят развивать ИТ в России, быть частью федеральных проектов в развитии таких комплексов как:
— личные кабинеты на сайте nalog.ru для всех категорий налогоплательщиков: физических и юридических лиц, индивидуальных предпринимателей, самозанятых. Сервис позволяет обращаться в налоговые органы без личного визита в инспекцию, получать всю актуальную информацию, осуществлять оплату начислений, заполнять декларации и многое другое;
— система применения контрольно-кассовой техники, которая дает потребителям дополнительную защиту своих прав, а владельцам ККТ позволяет снизить ежегодные расходы, в режиме реального времени следить за своими показателями, и лучше контролировать свой бизнес;
— система маркировки изделий из натурального меха, предназначенная для защиты рынка от «серой» продукции, разнообразных противоправных схем, в результате которых могут пострадать потребители, а также для борьбы с уклонением от уплаты налогов; 
— система маркировки лекарственных препаратов, необходимая для противодействия производству и обороту контрафактной и фальсифицированной продукции;
— автоматизированная информационная система «Налог 3», созданная для упрощения взаимодействия налогоплательщиков с налоговыми органами и обеспечения максимально полного и оперативного формирования сведений обо всех зарегистрированных в России индивидуальных предпринимателях и юридических лицах;
— единый государственный реестр записей актов гражданского состояния (ЕГР ЗАГС), созданный для повышения качества сбора информации, упрощения взаимодействия населения с органами ЗАГС.  Федеральная государственная информационная система ЕГР ЗАГС создаётся с использованием отечественного программного обеспечения и программно-аппаратных комплексов. В перспективе эта система станет основой федерального информационного ресурса о населении Российской Федерации;
— системы аналитической и управленческой отчетности;

И многих других…

Мы ждем как молодых специалистов, интересующихся прогрессивными технологиями, готовых обучаться и проявлять инициативу, так и опытных экспертов для решения глобальных, стратегических задач.

Вы получите уникальный опыт в области управления ИТ-инфраструктурой, СХД, внедрения и сопровождения ПО, сетевых технологий, СРК, информационной безопасности, СУБД, систем виртуализации и т.д. Сможете реализовать свой потенциал, работая с  High-End- оборудованием, таким платформами как: Exadata, Teradata, IBM Power, СКАЛА-Р, Полиматика и другие. Также получите уникальный опыт в части работы ПО и оборудования, внедряемого в рамках импортозамещения.  

Наш офис

Мы обеспечиваем непрерывное функционирование технологической инфраструктуры ФНС России 24/7/365, благодаря слаженной работе сотрудников филиалов, находящихся в разных уголках нашей страны, разных часовых поясах, при этом работающих интегрировано, как единое целое.  

Центр экспертизы сосредоточен в Москве, региональные подразделения в Санкт-Петербурге, Нижнем Новгороде, Хабаровске и Кемерово, Красноярске и Томске.

Мы предлагаем:
— Оформление c первого рабочего дня по ТК РФ
— График работы 5/2: пн-чт — с 10 до 19; пт — с 10 до 17:45
— Премирование по итогам работы (ежемесячное и ежеквартальное)
— Комфортные условия труда, молодой коллектив
— Корпоративное обучение (получение знаний по основам налогового законодательства)
— Возможность карьерного роста
— Основной отпуск 33 календарных дней
— Льготные путёвки для сотрудников и членов их семей на санаторно-курортное лечение и отдых

В Ваши задачи будет входить:
— Приём и обработка поступающих по телефону обращений налогоплательщиков, ответы на вопросы по налогообложению с использованием базы данных и сайта налоговой службы (ФНС России)
— Регистрация принятых вызовов в специализированном программном обеспечении

Пожелания к кандидату:
— Грамотная речь
— Стрессоустойчивость, вежливость, бесконфликтность, внимательность
— Умение работать с информацией
— Уверенный пользователь ПК

Преимуществом будет:
— Наличие опыта трудовой деятельности в контакт-центрах, либо в финансовой, банковской сферах

Колл-центр

На сегодняшний день невозможно представить работу поликлиники без помощи профессионального колл-центра.

За время функционирования колл центра постоянно проводятся работы по его совершенствованию. Для удобства пациентов мы запустили такие инструменты как: форма обращения на нашем сайте через мессенджер jivo, по номеру телефона WhatsApp +7 922-202-77-13. Также с сентября 2020 г на входящих звонках по номеру (343)227-01-72 мы тестируем систему голосового бота, которая позволяет, не дожидаясь длительного соединения с оператором получить ответ на вопрос или оставить заявку на обратный звонок. Пожалуйста, если вы оставили заявку на обратный звонок, не дублируйте свое обращение повторным звонком в колл центр или через WhatsApp. Мы стараемся оперативно и качественно обработать все обращения и обеспечить прием поступающих звонков.

Детский хирург, и.о. зав. ОНМП,
Поткин М.Е.

ВНИМАНИЕ!
Получить справочную информацию или записаться на прием к врачу вы можете с пн по пт с 8:00 до 20:00.
Для записи назовите: ФИО ребенка /дату рождения, либо номер карты (если знаете) или номер полиса ОМС.

Если Ваш вопрос не требует срочного решения, постарайтесь выбрать оптимальное время для звонка с 13:00 до 18:00 часов. Также предлагаем воспользоваться формой обратной связи jivo, расположенной на нашем сайте, либо написать нам в WhatsApp по номеру +7 922-202-77-13 в часы работы мессенджера с пн по пт с 10:00 до 15:00.

В рамках обращения в колл центр специалист может произвести запись к следующим врачам:

1. Участковому педиатру;
2. Офтальмологу;
3. Стоматологу;
4. Дерматологу;
5. Гинекологу;
6. В доврачебный кабинет;
7. Физиотерапевту.

Запись на обследования, к врачам иных специальностей осуществляется при личном обращении в регистратуру территориальной поликлиники при НАЛИЧИИ НАПРАВЛЕНИЯ!

Диспансерные пациенты имеют право записаться на консультацию к узкому специалисту по профилю диспансерного наблюдения, минуя консультацию участкового врача при наличии у них подтверждённого статуса «Д» — диспансерный пациент в программе АИС «МИР».

Приемная главного врача

 

ФНС откроет налоговые для личного приема граждан по записи

https://ria.ru/20200601/1572302847.html

ФНС откроет налоговые для личного приема граждан по записи

ФНС откроет налоговые для личного приема граждан по записи — РИА Новости, 01.06.2020

ФНС откроет налоговые для личного приема граждан по записи

Федеральная налоговая служба (ФНС) России с 15 июня открывает налоговые инспекции для личного приема по предварительной записи, сообщается на сайте службы. РИА Новости, 01.06.2020

2020-06-01T16:29

2020-06-01T16:29

2020-06-01T16:29

даниил егоров

федеральная налоговая служба (фнс россии)

общество

/html/head/meta[@name=’og:title’]/@content

/html/head/meta[@name=’og:description’]/@content

https://cdn22.img.ria.ru/images/149584/72/1495847245_0:0:3194:1796_1920x0_80_0_0_8b9c4c0d108a0f95345806eea34d21e6.jpg

МОСКВА, 1 июн — РИА Новости. Федеральная налоговая служба (ФНС) России с 15 июня открывает налоговые инспекции для личного приема по предварительной записи, сообщается на сайте службы.»С 15 июня ФНС России открывает налоговые инспекции для личного приема. С учетом эпидемиологической обстановки обратиться в налоговую можно по предварительной записи», — говорится в сообщении. Записаться на прием можно с понедельника, 1 июня, с помощью сервиса «Онлайн-запись на приём в инспекцию» или через единый контакт-центр ФНС.»ФНС России напоминает, что при посещении налогового органа обязательно ношение средств индивидуальной защиты в соответствии с правилами, принятыми в субъекте Российской Федерации», — отмечается в сообщении.Как сообщается на сайте ФНС России, ведомство приостанавливало личный прием и обслуживание налогоплательщиков с 30 марта до особого распоряжения в налоговых инспекциях и их подразделениях. В конце марта глава ФНС Даниил Егоров призвал россиян пользоваться онлайн-сервисами и бесплатным колл-центром при необходимости решить какие-либо налоговые вопросы.

https://ria.ru/20200521/1571761705.html

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2020

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

https://cdn25.img.ria.ru/images/149584/72/1495847245_30:0:2761:2048_1920x0_80_0_0_bb30d3b11bbc064784f6623c5a5353f5.jpg

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

даниил егоров, федеральная налоговая служба (фнс россии), общество

обслуживание на качественно-новом уровне — Журнал «Налоговая политика и практика»

В настоящее время ФНС России особое внимание уделяет повышению качества предоставления государственных услуг, которое невозможно без должного обеспечения открытости и доступности информации о деятельности налоговых органов. Эта задача потребовала разработки новых методологических основ и подходов к вопросам своевременного и профессионального информирования населения.

Чтобы обеспечить высокий уровень предоставления бесплатных информационных и консультационных услуг налогоплательщикам, разработана и утверждена концепция создания Единого контакт-центра Службы в архитектуре АИС «Налог-3». Среди целей его создания не только предоставление налогоплательщикам консультационных и информационных услуг на качественно новом уровне, но и значительное сокращение количества личных обращений налогоплательщиков в инспекции за счет дистанционного предоставления услуги. Следует напомнить, что в настоящее время уже действуют три call-центра, созданных на базе региональных центров обработки данных (ЦОД) в городах Волгоград, Нижний Новгород и Кемерово. Эти центры обслуживают «свои» регионы, предоставляя информацию общего характера (об особенностях налогообложения, режиме работы налоговых органов, регистрации и налоговом учете).

В 2011 году при Управлении ФНС России по г. Москве был создан специальный отдел с функциями контакт-центра, на базе которого в реальных условиях проводится отработка новых технологий, решений и
подходов по информированию налогоплательщиков. Все сотрудники контакт-центра прошли специальные тренинги по совершенствованию коммуникативных навыков и навыков консультирования клиентов, поскольку общение — это сложная психологическая процедура. Был расширен и состав информационных услуг, сформирована единая база знаний «Вопросы/ответы», которая в настоящее время постоянно пополняется в процессе обслуживания клиентов. Предоставление услуг полностью в автоматическом режиме позволило снизить время ожидания звонка в очереди. Подготовлены организационные и регламентирующие документы для использования в рамках Единого контакт-центра, а также начаты работы по созданию программного обеспечения для регистрации обращений налогоплательщиков. Сегодня около 30 операторов московского контакт-центра ежедневно обслуживают почти 2500 налогоплательщиков. На следующем этапе планируется объединение действующих call-центров в Единый контакт-центр, функционирующий на

общей платформе, по одним и тем же правилам. Кроме системы территориально распределенных подразделений со штатами операторов, осуществляющих обслуживание клиентов, контакт-центр также будет включать в себя центральный офис (руководящий орган).

Читать стать полностью в формате PDF

Бесплатный телефон горячей линии налоговой инспекции — контакт-центр ФНС для консультации

Госорганы › Единая налоговая справочная служба — номер телефона ИФНС для справок

Для обращения плательщиков по вопросам уплаты налогов и сборов работает телефон бесплатной горячей линии Налоговой службы России.

Налоговые органы России осуществляют, прежде всего, контроль за точным соблюдением налогового законодательства и обязательных платежей, правильностью и своевременным перечислением платежей в бюджет РФ. Кроме того, каждый гражданин России может обратиться в налоговые службы по бесплатному телефону.

По указанному номеру можно получить информацию об адресах и режиме работы налоговых инспекций, порядке получения налоговых вычетов, сроках уплаты налогов, процедурах госрегистрации и других возможностях электронных сервисов ФНС России, а также иную актуальную информацию по вопросам налогового администрирования.

Телефон горячей линии налоговой службы

Обратившись по указанному единому справочному номеру контакт-центра ФНС, любой плательщик налогов (физлицо или юрлицо) может задать вопросы по деятельности структур и подразделений указанной службы, получить полноценные консультации по налоговому учету, начислению, срокам и процессу уплаты налогов.

Бесплатная горячая линия налоговой службы России:

8 (800) 222-22-22

Звонки на рассматриваемый единый справочный телефон Налоговой службы бесплатны для звонящего с любого стационарного или мобильного аппарата, находящегося на территории нашей страны. Проще всего позвонить именно по этому номеру. Здесь вас всегда выслушают, или перенаправят нужному специалисту вашего региона. Для каждого региона существует свой налоговый орган. Если вы хотите обратиться именно в своей регион, наберите федеральный номер налоговой, там вам подскажут адрес или телефон инспекции вашего города.

Кроме того, граждане могут воспользоваться услугами принадлежащего им личного кабинета налогоплательщика.

Личный кабинет налогоплательщика www.nalog.ru

Личный кабинет налогоплательщика для физических лиц позволяет осуществить следующие действия:

  • Оформить или узнать собственный ИНН в Налоговой службе;
  • Владеть данными о возможной задолженности по любым видам налогов и сборов, погасить указанную задолженность в режиме онлайн, а также возвратить на собственный счет излишне перечисленные суммы налога;
  • Предоставить онлайн декларацию о своих доходах;
  • Получить причитающуюся вам налоговую компенсацию;
  • Проконсультироваться по всему спектру вопросов налогообложения;
  • Подать жалобу на действия или наоборот бездействие сотрудников налоговых органов.

Личный кабинет налогоплательщика для физических лиц

Личный кабинет для индивидуальных предпринимателей позволяет:

  • Предоставить пакет документов необходимых для осуществления регистрации предпринимательства в режиме онлайн на сайте Налоговой службы РФ;
  • Довести до сведения налоговых органов о факте изменения состояния расчетного счета;
  • Осуществить проверку контрагентов;
  • Предоставить собственную налоговую и бухгалтерскую отчетность;
  • Получить информацию о возможном отсутствии оплаты по любым сборам, при необходимости можно внести требуемую сумму в режиме реального времени, а также вернуть на свой расчетный счет излишне взысканные суммы налога;
  • Предоставить, необходимые данные для начала процедуры окончания деятельности ИП;
  • Получить подробные разъяснения по заданным вопросам;
  • Пожаловаться на действия налоговых органов.

Личный кабинет для индивидуальных предпринимателей

Личный кабинет налогоплательщика для юридических лиц дает возможность:

  • Предоставить нужные для проведения оформления юридического лица документы онлайн;
  • Поставить в известность налоговое ведомство об открытии или закрытии всех видов счетов;
  • Провести проверку контрагентов по базе ФНС;
  • Своевременно предоставить всю необходимую налоговую и бухгалтерскую документауию;
  • Получить данные о неполной уплате налогов, оплатить ее онлайн, а при необходимости возвратить на собственные счета, неверно уплаченные суммы налога;
  • Предоставить весь комплект документов требуемых для завершения деятельности организации или запуска процедуры банкротства данного юридического лица;
  • Получить все необходимые на данный момент пояснения по налоговым вопросам.

Личный кабинет налогоплательщика для юридических лиц

Контакты ФНС: официальный сайт

Контакты федеральной налоговой службы:

  • Официальный сайт ФНС России: www.nalog.ru
  • Личный кабинет налогоплательщика для физических лиц: lkfl.nalog.ru
  • Личный кабинет для индивидуальных предпринимателей: lkip.nalog.ru
  • Личный кабинет налогоплательщика для юридических лиц: lkul.nalog.ru
  • Направить обращение: www.nalog.ru
  • Соцсети: Фейсбук, Вконтакте, Твиттер
  • Электронная почта поддержки сайта nalog.ru: [email protected]

Отзывы

Справки для ФНС

Адреса клиник г. Казань

Адрес: ул. Гаврилова, 1, ост. «Гаврилова» (пр. Ямашева)

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00

Автобус: 10, 10а, 18, 33, 35, 35а, 36, 44, 45, 46, 49, 55, 60, 62, 76

Троллейбус: 2, 13

Трамвай: 5, 6

Адрес: ул. Т.Миннуллина, 8а, (Луковского) ост. «Театр кукол»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00

Автобус: 1, 2, 31, 37, 47, 74

Троллейбус: 6, 8, 12

Метро: Суконная слобода

 

 

Адрес: ул. Сыртлановой, 16, ст. метро Проспект Победы, ост. ул. Сыртлановой (проспект Победы)

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 5, 34, 37, 62 77

Трамвай: 5

Метро: Проспект Победы

Адрес: ул. Назарбаева, 10, ст. метро «Суконная Слобода», ост. «Метро Суконная Слобода»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: выходной

Автобус: 1, 4, 25, 43, 71

Метро: Суконная слобода

 

 

Адрес: ул. Декабристов, 180, ст. метро «Северный вокзал», ост. «Гагарина»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: выходной

Автобус: 6, 18, 29, 33, 37, 40, 43, 53, 62, 76, 78, 89

Троллейбус: 13

Трамвай: 1, 6

Метро: Северный вокзал

Адрес: пр. А.Камалеева, 28/9, (жилой комплекс «XXI век»), ост. «Новый ипподром»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Троллейбус: 3

 

 

Адрес: Дербышки, ул. Мира, 20, ост. «Магазин Комсомольский», «Гвоздика»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 1, 19, 25, 34, 44, 60, 84

Адрес: ул. Серова, 22/24, ост. «ул. Серова»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 10, 10а

 

 

Адрес: ул. Беломорская, 6, ст. метро «Авиастроительная», ост. «ул. Ленинградская»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 6, 18, 33, 37, 40, 42, 43, 53, 60, 78, 89, 93

Троллейбус: 13

Трамвай: 1

Метро: Авиастроительная

Адрес: ул. Закиева, 41а, ост. «Кабельное телевидение»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 5, 18, 30, 31, 34, 45, 46, 62, 63, 77, 89

Троллейбус: 3, 5, 9, 12

 

 

Адрес: ул. Кул Гали, 27, ост. «ул. Кул Гали» (ул. Габишева)

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: выходной

Автобус: 46, 90

Адрес: ул. Рихарда Зорге, 95, м. «Дубравная», ост. «ул. Юлиуса Фучика»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00

Автобусы: 5, 18, 30, 31, 33, 34, 45, 68, 74, 77

Троллейбусы: 5, 9, 12

Трамвай: 4

Метро: Дубравная

Адрес: ул. Фрунзе, 3а, ост. «Идель»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8:00-14:00 

Автобусы: 10а, 36, 49, 53, 63, 72, 106

Троллейбус:1

 

Врожденные ошибки IFN-иммунитета I типа у пациентов с опасным для жизни COVID-19

Врожденные пороки иммунитета к IFN I типа у пациентов с опасным для жизни COVID-19

Цянь Чжан, Пол Бастард, Чжиюн Лю, Жереми Ле Пен, Марсела Монкада-Велес, Джи Чен, Масато Огиши, Ира К.Д. Сабли, Стефани Ходейб, Сесилия Король, Жереми Розайн, Кая Билгувар, Джункио Йе, Александрета Бигзэ , Руи Ян, Андрес Аугусто Ариас, Циньхуа Чжоу, Ю Чжан, Фанни Оноди, Сарантис Корниотис, Леа Карпф, Квентин Филиппот, Марва Чбихи, Люси Боннет-Мадин, Карим Доргам, Никайя Смит, Уильям М.Шнайдер, Брэндон С. Разуки, Ханс-Генрих Хоффманн, Элефтериос Михайлидис, Лин Моенс, Джи Ын Хан, Лазаро Лоренцо, Люси Бизьен, Филип Мид, Анна-Лена Нихус, Эйлин Камилла Угурбил, Орелиен Корно, Гаспард Цанган Кернер, Пенкен Рапапорт, Йоанн Зелеутнер, Джереми Манри, Сесиль Массон, Йоханн Шмитт, Агата Шлютер, Том Ле Войер, Таушиф Хан, Хуан Ли, Жак Феллай, Люси Руссель, Мохаммад Шахруэй, Мохаммед Ф. Алосайми, Давуд Хадсури, Давуд Мансури, Аль-Мулла, Ферас Альмурфи, Салех Заид Аль-Мухсен, Фахад Альшиме, Саид Аль Турки, Рана Хасанато, Дидерик ван де Бик, Андреа Бионди, Лаура Рахель Беттини, Мариэлла Д’Анджио, Паоло Бонфанти, Луиза Имберти, Алессандри Симоне Пагера, Евгения Кирос-Ролдан, Камилло Росси, Эндрю Дж.Олер, Миранда Ф. Томпкинс, Камилла Альба, Изабель Вандернот, Жан-Кристоф Гоффар, Гийом Смитс, Изабель Мигеотт, Филомин Херинк, Пере Солер-Паласин, Андреа Мартин-Налда, Роджер Колобран, Пьер-Эммануэль Моранж, Севги Келес, Севги Келес , Тайфун Озчелик, Кадрие Карт Ясар, Севтап Сеноглу, Шемси Нур Карабела, Карлос Родригес-Галлего, Джузеппе Новелли, Сами Грайех, Ясин Танджауи-Ламбьотт, Ксавье Дюваль, Cédric Laouénan Clinic, COVID, COVID, клиника COVID, COVID, COVID COVID Cohort Study Group, CoV-Contact Cohort, Amsterdam UMC Covid-19 Biobank, COVID Human Genetic Effort, NIAID-USUHS / TAGC COVID Immunity Group, Andrew L.Сноу, Клифтон Л. Далгард, Джошуа Д. Милнер, Дональд Винь, Трине Х. Могенсен, Нико Марр, Андраш Н. Спаан, Бертран Буассон, Стефани Буассон-Дюпюи, Хасинта Бустаманте, Анн Пуэль, Майкл Дж. Чианканелли, Изабель Мейтс, Том Маниатис, Василий Сумелис, Али Амара, Мишель Нуссенцвейг, Адольфо Гарсиа-Састре, Флориан Краммер, Аврора Пухоль, Дарра Даффи, Ричард П. Лифтон, Шен-Ин Чжан, Гай Горохов, Вивьен Безиат, Эммануэль Джоуи Симидзу, Чарльз М. Райс, Лоран Абель, Луиджи Д.Нотаранджело, Орели Кобат, Хелен С. Су, Жан-Лоран Казанова

Наука

Врожденные ошибки IFN-иммунитета I типа у пациентов с опасным для жизни COVID-19

Врожденные ошибки IFN-иммунитета I типа у пациентов с опасным для жизни COVID-19

Цянь Чжан, Пол Бастард, Чжиюн Лю, Жереми Ле Пен, Марсела Монкада-Велес, Цзе Чен, Масато Огиси, Ира К. Д. Сабли, Стефани Ходейб, Сесилия Король, Жереми Розен, Кая Бильгувар, Цзюньцян Е, Александр Бользе, Бенедетта Бигио, Руи Ян, Андрес Аугусто Ариас, Циньхуа Чжоу, Ю Чжан, Фанни Оноди, Сарантис Корниотис, Леа Карпф, Квентин Филиппот, Марва Чбихи, Люси Боннет-Мадин, Карим Доргам, Никайя Смит, Уильям М.Шнайдер, Брэндон С. Разуки, Ханс-Генрих Хоффманн, Элефтериос Михайлидис, Лин Моенс, Джи Ын Хан, Лазаро Лоренцо, Люси Бизьен, Филип Мид, Анна-Лена Нихус, Эйлин Камилла Угурбиль, Орелиен Корно, Гаспар Кернер, Пэн Чжан, Франк Рапапорт, Йоанн Зелеутнер, Джереми Манри, Сесиль Массон, Йоханн Шмитт, Агата Шлютер, Том Ле Войер, Таушиф Хан, Хуан Ли, Жак Феллай, Люси Руссель, Мохаммад Шахруэй, Мохаммед Ф. Алосайми, Давуд Мансури, Хайя Аль-Сауд, Фахд Аль-Мулла, Ферас Альмурфи, Салех Заид Аль-Мухсен, Фахад Альшиме, Саид Аль Турки, Рана Хасанато, Дидерик ван де Бик, Андреа Бионди, Лаура Рашель Беттини, Мариэлла Д’Анджио, Паоло Бонфанти, Луиза Имберти, Алессандра Соттини, Симоне Пагера, Евгения Кирос-Ролдан, Камилло Росси, Эндрю Дж.Олер, Миранда Ф. Томпкинс, Камилла Альба, Изабель Вандернут, Жан-Кристоф Гоффар, Гийом Смитс, Изабель Мигеотт, Филомин Хэринк, Пере Солер-Паласин, Андреа Мартин-Налда, Роджер Колобран, Пьер-Эммануэль Моранж, Севги Келес, Фатьма Чёлкесен, Тайфун Озчелик, Кадрие Карт Ясар, Севтап Сеноглу, Чемси Нур Карабела, Карлос Родригес Гальего, Джузеппе Новелли, Сами Грайех, Ясин Танджауи-Ламбьотт, Ксавье Дюваль, Седрик Лауэнан, клиницисты COVID-STORM, клиницисты COVID, Imagine COVID Group, Французская группа когортных исследований COVID, CoV-Contact Cohort, Амстердам, UMC Биобанк Covid-19, COVID Human Genetic Effort, NIAID-USUHS / TAGC Группа иммунитета к COVID, Эндрю Л.Сноу, Клифтон Л. Далгард, Джошуа Милнер, Дональд Винь, Трина Х. Могенсен, Нико Марр, Андраш Н. Спаан, Бертран Буассон, Стефани Буассон-Дюпюи, Хасинта Бустаманте, Энн Пуэль, Майкл Чианканелли, Изабель Мейтс, Том Маниатис, Васили Сумелис, Али Амара, Мишель Нуссенцвейг, Адольфо Гарсия-Састре, Флориан Краммер, Аврора Пужол, Дарра Даффи, Ричард Лифтон, Шен-Ин Чжан, Гай Горохов, Вивьен Безиа, Эммануэль Жуанги, Ванесса Санчо-Симидзу, Чарльз М.Райс, Лоран Абель, Луиджи Д. Нотаранджело, Орели Кобат, Хелен С. Су, Жан-Лоран Казанова

Материалы / методы, дополнительный текст, таблицы, рисунки и / или ссылки

Загрузить приложение
  • Материалы и методы
  • Рис. S1 — S11
  • Таблицы S1 и S2
  • Ссылки
Контрольный список воспроизводимости MDAR
Корректировка (22 октября 2020 г.): В предыдущей версии дополнительных материалов мы писали, что протестировали 113 из 118 вариантов обнаружены у пациентов с опасным для жизни COVID-19.У нас есть теперь добавлены данные по оставшимся пяти вариантам и соответственно скорректированы цифры.
Оригинальная версия доступна здесь.

Врожденные пороки иммунитета к IFN I типа у пациентов с опасным для жизни COVID-19

Врожденные пороки иммунитета к IFN I типа у пациентов с опасным для жизни COVID-19

Авторы: Цянь Чжан, Пол Бастард, Чжийонг Лю, Жереми Ле Пен, Марсела Монкада-Велес, Цзе Чен, Масато Огиши, Ира К.Д. Сабли, Стефани Ходейб, Сесилия Король, Жереми Розен, Кая Бильгувар, Цзюньцян Йе, Александр Больз, Бенедетта Бигио, Руи Ян, Андрес Аугусто Ариас, Циньхуа Чжоу, Ю Чжан, Фанни Оноди, Сарантис Корниотпис, Леа Марва Чбихи, Люси Боннет-Мадин, Карим Доргам, Никайя Смит, Уильям М. Шнайдер, Брэндон С. Разуки, Ханс-Генрих Хоффманн, Элефтериос Михайлидис, Лин Моенс, Джи Юн Хан, Лазаро Лоренцо, Люси Бизьен, Филип Мид, Анна- Лена Нихус, Эйлин Камилла Угурбиль, Орелиен Корно, Гаспар Кернер, Пэн Чжан, Франк Рапапорт, Йоанн Зелеутнер, Джереми Манри, Сесиль Массон, Йоханн Шмитт, Агата Шлютер, Том Ле Войер, Таушиф Хан, Хуан Ли, Жакан Мохаммад Шахруэй, Мохаммед Ф.Алосайми, Давуд Мансури, Хайя Аль-Сауд, Фахд Аль-Мулла, Ферас Альмурфи, Салех Заид Аль-Мухсен, Фахад Альшиме, Саид Аль Турки, Рана Хасанато, Дидерик ван де Бик, Андреа Бионди, Лаура Рахель Д’Анджелла, Мариоэлла ‘, Паоло Бонфанти, Луиза Имберти, Алессандра Соттини, Симона Пагера, Юджиния Кирос-Ролдан, Камилло Росси, Эндрю Дж. Олер, Миранда Ф. Томпкинс, Камилла Альба, Изабель Вандернут, Жан-Кристоф Гоффар, Гийом Филом Смитс, Изабель Менидж Херинк, Пер Солер-Паласин, Андреа Мартин-Налда, Роджер Колобран, Пьер-Эммануэль Моранж, Севги Келес, Фатма Тёлькесен, Тайфун Озчелик, Кадрие Карт Ясар, Севтап Сеноглу, Шемси Нур Карабела, Карлос-Гальперагес, Карлос-Гальперагес, Гиаллип-Гальперагес , Ясин Танджауи-Ламбьотт, Ксавье Дюваль, Седрик Лауэнан, клиницисты COVID-STORM, клиницисты COVID, Imagine COVID Group, Французская группа когортных исследований COVID, CoV-Contact Cohort, Амстердам UMC Биобанк Covid-19, COVID Human Genetic Effort-USUHS / TAGC COVID Immunity Group, Эндрю Л. .Сноу, Клифтон Л. Далгард, Джошуа Д. Милнер, Дональд Винь, Трине Х. Могенсен, Нико Марр, Андраш Н. Спаан, Бертран Буассон, Стефани Буассон-Дюпюи, Хасинта Бустаманте, Анн Пуэль, Майкл Дж. Чианканелли, Изабель Мейтс, Том Маниатис, Василий Сумелис, Али Амара, Мишель Нуссенцвейг, Адольфо Гарсиа-Састре, Флориан Краммер, Аврора Пухоль, Дарра Даффи, Ричард П. Лифтон, Шен-Ин Чжан, Гай Горохов, Вивьен Безиат, Эммануэль Джоуи Симидзу, Чарльз М. Райс, Лоран Абель, Луиджи Д.Нотаранджело, Орели Кобат, Хелен С. Су, Жан-Лоран Казанова

Наука

границ | Высокая доза IFN-β активирует GAF для усиления экспрессии генов-мишеней ISGF3 в эпителиальных клетках MLE12

Введение

Ответ интерферона типа I (IFN) важен для противовирусного иммунитета хозяина. Клетки респираторного эпителия, особенно клетки альвеолярного типа II, являются основной мишенью респираторных патогенов и способны как продуцировать интерфероны, так и отвечать на них (1–7).Передача сигналов IFN типа I индуцирует экспрессию стимулированных IFN генов (ISG), которые кодируют антивирусные эффекторные молекулы, а также хемокины, цитокины и другие иммунные эффекторные молекулы (5, 8). Следовательно, дефекты передачи сигналов IFN типа I приводят к восприимчивости к различным инфекциям, тогда как чрезмерные ответы IFN связаны с усиленным и патологическим воспалением (9–14). Следовательно, регуляция передачи сигналов IFN типа I критически важна, поскольку его неправильная регуляция в любом направлении может привести к заболеванию.

Сигнал IFN-β типа I через рецептор IFN типа I (IFNAR), состоящий из субъединиц IFNAR1 и IFNAR2 (15). IFNAR связан с тирозинкиназами Janus JAK1 и TYK2. После связывания лиганда IFNAR связывает киназы JAK1 / TYK2, перекрестно фосфорилируя и активируя трансдуктор сигнала и активатор транскрипции (STAT) белков STAT1 и STAT2. Фосфорилированные STAT1 и STAT2 взаимодействуют с IRF9 с образованием тримерного фактора транскрипции (TF) ISGF3, который связывается с интерферон-стимулированными элементами ответа (ISRE), определяемыми последовательностью AGTTTCn 2 TTTC (16).

STAT1 может также образовывать гомодимер (17), названный γ -активированным фактором (GAF), который обычно индуцируется стимуляцией IFN типа II, IFN- γ (18). GAF связывается с гамма-активированными последовательностями (GAS), определяемыми мотивом TTCn 2-4 GAA (19), а IFN- γ играет хорошо описанную роль в иммунных клетках, таких как макрофаги (20). Примечательно, однако, что передача сигналов IFN типа I может также активировать GAF как в иммунных, так и в неиммунных клетках (1, 18, 21, 22). Хотя это наблюдается в течение десятилетий, функция GAF, индуцированного IFN I типа, неясна.Возможно, что GAF и ISGF3 играют избыточную роль в регуляции генов, поскольку IFN типа I и типа II, как сообщалось, индуцируют сильно перекрывающиеся программы экспрессии генов (23, 24). На сегодняшний день, однако, мало исследований систематически изучали роль GAF, индуцированного IFN типа I, с использованием общегеномных подходов.

Здесь мы сообщаем, что в линии эпителиальных клеток легких мышей IFN- β активирует как ISGF3, так и GAF, но в различных количествах в зависимости от дозы IFN- β . Мы демонстрируем, что при высоких дозах IFN-β GAF усиливает ISGF3-чувствительную экспрессию ISG во всем геноме, но что связывания только GAF недостаточно для экспрессии гена.

Материалы и методы

Культура клеток

Клетки MLE-12, полученные из ATCC (Манассас, Вирджиния), культивировали в DMEM (Corning Inc., Корнинг, Нью-Йорк) с добавлением 10% FBS, 100 МЕ / мл пенициллина, 100 μ г / мл стрептомицина, 2 мМ L-глутамина при 37 0 ° C при 5% CO 2 . Было подтверждено, что клетки не заражены микоплазмами. Рекомбинантный мышиный IFN-β (PBL Assay Science, Piscataway, NJ) и IFN-γ (BD Biosciences, San Jose, CA) использовали для стимуляции.Для экспериментов с циклогексимидом клетки инкубировали в течение 20 минут со средой, содержащей 10 мкл мкг / мл циклогексимида, перед стимуляцией IFN.

Библиотеки ChIP-Seq

Клетки MLE-12, выращенные до 80% слияния на 15-см планшетах, дважды сшивали 2 мМ дисукцинимидилглутарата в PBS в течение 30 минут и 1% -ным формальдегидом без метанола в PBS в течение 10 минут при комнатной температуре. (RT). Реакции перекрестного сшивания гасили 125 мМ глицина в течение 5 минут при комнатной температуре, после чего клетки дважды промывали холодным PBS с добавлением 1 мМ EDTA.Затем сшитые клетки соскребали в PBS с EDTA, собирали центрифугированием и замораживали при -80 ° C. Осадки клеток размораживали в буфере для лизиса 1 (50 мМ HEPES-KOH pH 7,6, 140 мМ NaCl, 1 мМ EDTA, 10% глицерин, 0,5% NP-40, 0,25% Triton X-100 и 1x коктейль ингибиторов протеазы (Thermo Fisher Scientific, Waltham, MA)) на льду и инкубировали при 4 ° C в течение 7 мин. Затем клетки обрабатывали ультразвуком с помощью ультразвуковой системы Diagenode Bioruptor 300 при средней интенсивности в течение 15 секунд ВКЛ / 30 секунд ВЫКЛ в течение 3 циклов в 1.5 мл микропробирки TPX и центрифугируют для выделения ядер. Ядра промывали буфером для лизиса 2 (10 мМ Трис-HCl pH 8,0, 200 мМ NaCl, 1 мМ EDTA, 0,5 мМ EGTA и 1x коктейль ингибиторов протеазы) при комнатной температуре в течение 10 минут. После центрифугирования ядра ресуспендировали в буфере для лизиса 3 (10 мМ трис-HCl pH 8,0, 100 мМ NaCl, 1 мМ ЭДТА, 0,5 мМ EGTA, 0,1% дезоксихолата натрия, 0,5% N-лауроилсаркозина и 1x коктейль ингибиторов протеазы) и обрабатывали ультразвуком. в микропробирках TPX при низкой интенсивности в течение 30 секунд ВКЛ / 30 секунд ВЫКЛ в общей сложности 12 циклов при инвертировании и импульсном вращении через каждые 4 цикла.После центрифугирования образцов на максимальной скорости в течение 10 минут при 4 ° C супернатант, содержащий фрагментированный хроматин, разбавляли 6 объемами буфера для разведения (10 мМ трис-HCl pH 8,0, 160 мМ NaCl, 1 мМ EDTA, 0,01% SDS, 1,2% Triton X-100, 1x коктейль ингибиторов протеазы) и инкубировали с Protein-G Dynabeads (Thermo Fisher) в течение 2 часов при 4 ° C для предварительной очистки. Затем хроматин инкубировали с 5 мг антитела STAT1 (Cell Signaling Technologies, Danvers, MA; CST-9172) для каждой 1/2 чашки клеток при 4 ° C в течение ночи.

Затем комплексы антитело-хроматин подвергали иммунопреципитации путем инкубации с протеином G Dynabeads в течение 5 часов при 4 ° C. Гранулы собирали и дважды промывали следующими буферами: буфер с низким содержанием соли (50 мМ HEPES-KOH pH 7,6, 140 мМ NaCl, 1 мМ ЭДТА, 1% Тритон X-100, 0,1% дезоксихолата натрия, 0,1% SDS), высокое содержание соли. буфер (50 мМ HEPES-KOH pH 7,6, 500 мМ NaCl, 1 мМ EDTA, 1% Triton X-100, 0,1% Na Deoxycholate, 0,1% SDS), буфер LiCl (20 мМ Tris-HCl pH 8,0, 250 мМ LiCl, 1 мМ ЭДТА, 0,5% дезоксихолата натрия, 0.5% NP-40) и буфера TE (10 мМ Tris-HCl pH 8,0, 1 мМ EDTA). Иммунопреципитированные комплексы хроматина обрабатывали РНКазой A (Thermo Fisher) при 37 ° C в течение одного часа, и сшивки обращали с помощью 10% SDS и 0,6 мг / мл протеиназы K (New England Biolabs, Ipswich, MA) в течение ночи при встряхивании при 65 ° C. С. Иммунопреципитированные фрагменты ДНК очищали с помощью гранул AMPure XP SPRI (Beckman Coulter, Brea, CA) при объемном соотношении 0,95 в соответствии с инструкциями производителя.

ДНК

количественно определяли с помощью Qubit dsDNA HS (Life Technologies, Карлсбад, Калифорния) с использованием Qubit 2.0 флуорометр. Библиотеки были подготовлены для секвенирования с использованием набора NEBNext Ultra II DNA Library Prep Kit (New England Biolabs) с NEBNext Multiplex Oligos (New England Biolabs). Каждую библиотеку готовили из 1-5 нг исходной ДНК. Входные образцы были объединены из образцов из того же эксперимента. Конечные библиотеки проверяли на качество с помощью агарозного геля, количественно оценивали с помощью Qubit и мультиплексировали максимум с 24 образцами на реакцию секвенирования. Библиотеки секвенировали на Illumina HiSeq 2500 с односторонним считыванием 50 пар оснований в Исследовательском центре широких стволовых клеток Калифорнийского университета в Лос-Анджелесе.

Библиотеки RNA-Seq

Общую РНК очищали от тризола с помощью набора DIRECTzol (Zymo Research, Ирвин, Калифорния) в соответствии с инструкциями производителя. Для данных на фиг. 3, 5A, 6B, 6G, S2 и S3 библиотеки РНК-seq были подготовлены с использованием набора библиотеки цепочечных мРНК-seq KAPA в соответствии с инструкциями производителя и секвенированы на одном конце при длине считывания 50 п.н. на Illumina HiSeq 2500. Для данных на рисунках 5D, 5E, 6C-F библиотеки РНК-seq были созданы MedGenome, Inc. (Фостер-Сити, Калифорния) с использованием наборов мРНК TruSeq с цепочкой цепей Illumina и секвенированы по парным концам при длине считывания 150 п.н. .

BMDM Data

Необработанные данные ChIP-seq и RNA-seq (21) были загружены из архива чтения последовательностей NCBI под номерами доступа SRP149943 (STAT1, STAT2 и IRF9 ChIP-seq) и SRP149944 (RNA-seq). Данные были загружены в виде файлов fastq и обработаны таким же образом, как и данные, полученные в нашей лаборатории.

Анализ ChIP-Seq

Три конца считывания низкого качества были обрезаны (отсечка q = 30), а оставшиеся последовательности адаптеров были удалены с помощью программы cutadapt (25). Показания были выровнены с использованием Bowtie2 (26) с использованием — недетерминированных и — очень чувствительных параметров.Пики вызывались в каждой выборке против входного контроля вызывающей стороны MACS2 (27) с порогом FDR 0,01 со следующими параметрами: keep-dup 1 —call-summit —nomodel —extsize 200. Пики для каждой выборки были объединены для генерации справочный список пиков. Каждый файл BAM был нормализован на основе его глубины секвенирования с помощью deepTools (28). Нормализованные чтения по глубине секвенирования подсчитывались в пределах каждого пика командой multiBigWigSummary из deepTools для создания таблицы подсчета. Индуцируемые пики были идентифицированы с использованием порога двукратной индукции от базового состояния, по крайней мере, в двух временных точках.

Одна повторность стимуляции MLE12 IFN-β через 0,5 часа имела особенно высокое отношение сигнал / шум, что приводило к 10-кратному увеличению числа пиков по сравнению с другими образцами. Мы включили этот образец в идентификацию возможных пиков STAT1, но исключили его для обнаружения индуцируемых пиков, тем самым максимизируя количество рассматриваемых пиков, но строго определяя индуцируемые пики. Кластерный анализ K-средних был выполнен на масштабированных логарифмах 2 нормализованных тегов ChIP-seq. Графики силуэта и локтя были исследованы для определения наилучшего k из 2 из данных. De novo Анализ мотивов был выполнен в пределах пиков с использованием функции findMotifsGenome в пакете HOMER (29). Тепловые карты были созданы с помощью пакета pheatmap от R (30). Версия базы данных Ensembl от апреля 2019 года использовалась для извлечения информации о сайте начала транскрипции и аннотирования пиков относительно генов. Файлы Bigwig были созданы с помощью функции bamCoverage в deeptools, а треки были визуализированы в IGV (31).

Кластеризация мотивов ChIP-Seq

Категоризация пиков STAT1 на основе мотивов была выполнена путем поиска в базе данных HOMER (29) файлов взвешенных по положению матричных файлов мотивов STAT / GAS и ISRE / IRF.Мотивы ISRE / IRF включали мотивы для T1ISRE, ISRE, IRF2, IRF1, IRF3 и IRF8. Мотивы STAT / GAS включали мотивы для STAT1, STAT3 + IL-21, STAT3, STAT4 и STAT5 (рисунок S1B). Вариант мотива GAS в промоторе Irf1 (GATTTCCCCGAATG), который, как известно, связывается с STAT1 (32), также был включен в поиск в качестве мотива GAS. Функцию annotatePeaks в HOMER использовали для сканирования на наличие мотивов в индуцибельных пиках STAT1. Пик, который содержал по крайней мере один вид мотива STAT / GAS, классифицировался как пик GAS, а пик, который содержал по крайней мере один вид мотива ISRE / IRF, классифицировался как пик ISRE.Пик, который содержал мотивы из категорий как STAT / GAS, так и ISRE / IRF, был классифицирован как ОБА пика, в то время как пик, который не содержал ни одного из мотивов, был классифицирован как пик без мотива.

Анализ RNA-Seq

Считанные данные были обрезаны, отфильтрованы и дедуплицированы таким же образом, как и данные ChIP-seq. Обработанные чтения были сопоставлены с геномом mm10 с помощью STAR (33), а таблицы подсчета были созданы с помощью функции featureCount в deepTools (34). Подсчеты были нормализованы с использованием метода TMM-нормализации, а значения RPKM были получены с использованием edgeR (35).Гены ниже порога экспрессии 2 CPM во всех образцах были исключены из последующего анализа. Индуцибельные гены IFN- β (фиг. 3A) были идентифицированы по FDR <0,05 и кратности изменения> 2 по сравнению с нестимулированными. Для вычислений кратности изменения и оценки улучшения был добавлен псевдосчет 1 RPKM. Анализ онтологии генов был выполнен с использованием базы данных для аннотаций, визуализации и интегрированного обнаружения (36). Для визуализации данных использовались пакеты pheatmap и ggplot2 (30, 37).

Анализ сдвига электрофоретической подвижности (EMSA)

После стимуляции IFN клетки соскребали в холодном PBS + 1 мМ EDTA, собирали центрифугированием и ресуспендировали в буфере цитоплазматического экстракта (10 мМ HEPES-KOH pH 7,9, 60 мМ KCl, 1 мМ EDTA, 0,5% NP40, 1 мМ DTT и 1 мМ PMSF). После инкубации на льду в течение двух минут клетки встряхивали в течение 30 секунд, ядра собирали центрифугированием и ресуспендировали в буфере для ядерных экстрактов (250 мМ Трис pH 7,5, 60 мМ KCl, 1 мМ EDTA, 1 мМ DTT и 1 мМ PMSF. ).Ядра быстро замораживали и хранили при -80 ° C перед использованием.

Ядерные экстракты получали путем разрушения ядерной мембраны с помощью трех циклов замораживания-оттаивания по 30 секунд каждый с использованием водяной бани 37 ° C и сухого льда с последующим центрифугированием на максимальной скорости в течение 15 минут. Полученные супернатанты, содержащие ядерные белки, затем инкубировали с олигонуклеотидными зондами, меченными P 32 , в течение 15 минут в связывающем буфере (10 мМ Трис, pH 7,5, 50 мМ NaCl, 10% глицерина, 1% NP40, 1 мМ EDTA, 0.1 мг / мл полидезоксиинозин-дезоксицитидиловой кислоты). Для определения активности связывания ДНК ISGF3 и GAF использовали следующие зонды: зонд ISRE (GATCCTCGGGAAAGGGAAACCTAAACTGAAGCC) и зонд GAS (TACAACAGCCTGATTTCCCCGAAATGACGC). Реакционные смеси прогоняли на 5% акриламидном геле (30: 0,8) с 5% глицерином и буфером TGE (24,8 мМ Трис, 190 мМ глицин, 1 мМ EDTA) при 200 В в течение 1 часа 45 минут. Гели сушили и отображали на Sapphire Biomolecular imager в люминофорном режиме (Azure Biosystems, Дублин, Калифорния).

Вестерн-блот

Клетки лизировали 1x буфером Лэммли (62,5 мМ Tris pH 6,8, 2% SDS, 10% глицерин, 5% β -меркаптоэтанол и бромфеноловый синий) и кипятили при 95 ° C в течение 15 дней. минут. Денатурированные белки подвергали электрофорезу на акриламидном геле и переносили на нитроцеллюлозу. Использовали следующие антитела: кроличьи анти-IRF1 (sc640), козьи анти-актиновые (sc1615), ослиные анти-козьи HRP (sc2020) от Santa Cruz Biotechnology и мышиные анти-кроличьи HRP (CST 7074) от Cell Signaling Technology.Иммуноблоты были разработаны с использованием хемилюминесцентного субстрата (Supersignal West Pico Plus, Thermo Fisher) и визуализированы с использованием системы визуализации ChemiDoc MP (Bio-Rad, Hercules, CA).

Результаты

IFN-

β Индуцированный STAT1 связывается с GAS и мотивами ISRE

Чтобы охарактеризовать TF, активированные IFN-β в клетках MLE-12, мы провели анализ сдвига электрофоретической подвижности (EMSA) с зондами ISRE и GAS. Устойчивое связывание белка с зондами ISRE и GAS было обнаружено в ответ на IFN-β (10 Ед / мл), что указывает на индуцибельную активность ISGF3 и GAF, соответственно (рис. 1A).Сигнал GAS достиг максимума в течение одного часа после стимуляции, тогда как сигнал ISRE постепенно увеличивался и достиг пика через два часа.

Рисунок 1 IFN- β Индуцированный STAT1 связывается с мотивами GAS и ISRE. (A) EMSA связывания GAS и ISRE в клетках MLE12, обработанных IFN- β (100 Ед / мл). NFY показан в качестве контроля нагрузки. Данные представляют более 5 независимых экспериментов. (B) STAT1 Тепловая карта ChIP-seq индуцируемых пиков STAT1 (FDR <0.01 для пикового вызова и> 2-кратной индукции по крайней мере в двух временных точках) после стимуляции IFN- β (10 Ед / мл). Пики были сгруппированы с использованием кластеризации k-средних. (C) Три лучших совпадения по результатам анализа мотивов de novo на пиках STAT1 в кластере 1 и 2, как определено в (B) . (D) IFN- γ (100 нг / мл) индуцированный сигнал STAT1 ChiP-seq, сравнивая местоположения в кластере 1 и 2. (E) Гистограмма с накоплением количества пиков в кластере, которые содержат ISRE, GAS , или ОБЕИХ мотивов путем поиска в базе данных HOMER (см. рисунок S1). (F) Повторно кластеризованная тепловая карта STAT1 ChIP-seq на основе категорий мотивов. (G) Геномный браузер отслеживает репрезентативные пики STAT1 ChIP-seq, связанные с промотором, из ОБОИХ ( Isg15 ), GAS (Ripk1) и ISRE ( Usp18 ) категорий.

Чтобы изучить события связывания ISGF3 и GAF по всему геному, мы выполнили STAT1 ChIP-seq в различные моменты времени после стимуляции IFN-β. Всего было идентифицировано 723 индуцибельных пика STAT1. Кластеризация K-средних выявила два кластера пиков с отличительной кинетикой (рис. 1B).Кластер 1 содержал 353 пика, которые наиболее сильно индуцировались через полчаса и продолжались до двух часов после стимуляции. Кластер 2 содержал 370 пиков, которые наиболее сильно индуцировались через два и четыре часа после стимуляции.

Поскольку STAT1 является членом как ISGF3, так и GAF, мы выполнили анализ мотивов de novo на геномных областях в каждом кластере, чтобы сделать вывод об идентичности STAT1-содержащих комплексов. Пики в кластере 1 были сильно обогащены GAS-подобным мотивом ( p = 10 e-255), в то время как пики в кластере 2 были высоко обогащены ISRE-подобным мотивом ( p = 10 e-350). (Рисунок 1С).Чтобы подтвердить результат нашего анализа мотивов, мы выполнили STAT1 ChIP-seq в ответ на стимуляцию IFN- γ , которая сильно активирует GAF. Как и ожидалось, пики в кластере 1 показали большее связывание STAT1, индуцируемое IFN- γ , чем пики в кластере 2 (рис. 1D). Эти результаты подтвердили, что пики STAT1 в кластере 1 представляют связывание GAF, а пики в кластере 2 представляют связывание ISGF3.

Мы также выполнили STAT1 ChIP-seq с циклогексимидом (CHX) и без него, чтобы исследовать, зависит ли связывание GAF от индуцированного IFN-β синтеза белка de novo вторичных сигналов, такого как IFN- γ .Мы обнаружили, что добавление CHX не уменьшало сигнал ChIP ни в кластере 1, ни в кластере 2 (рисунок S1A), что указывает на то, что передача сигналов IFN- β непосредственно активирует GAF без необходимости синтеза белка.

Чтобы дополнить подход беспристрастной кластеризации, мы классифицировали пики на основе известных мотивов связывания GAS и ISRE. Мы тщательно просканировали базу данных HOMER (29) на наличие мотивов STAT / GAS и ISRE / IRF под 723 пиками (рисунок S1B). Мы обнаружили, что для кластера 1 262 из 353 пиков (74%) имели только мотивы STAT / GAS, 35 пиков (10%) содержали мотивы STAT / GAS и ISRE / IRF (ОБА мотивы) и 8 пиков (2%). ) имел только мотивы ISRE / IRF (рис. 1E).Для кластера 2 193 из 370 пиков (52%) имели только мотивы ISRE / IRF, 120 пиков (32%) имели ОБЕ мотивы, а 18 пиков (5%) имели только мотивы STAT / GAS (рис. 1E). В целом, этот анализ классификации мотивов привел к 280 пикам, которые имели только мотивы STAT / GAS (классифицированные как пики GAS), 155 пикам, которые имели мотивы как STAT / GAS, так и ISRE / IRF (ОБЕ ​​пики), и 201 пику, которые имели только ISRE. / Мотивы IRF (пики ISRE). Повторно кластеризованная тепловая карта с использованием этих категорий (рис. 1F) резюмировала различные временные паттерны связывания STAT1, наблюдаемые при кластеризации K-средних.В качестве примеров, пики из категорий мотивов BOTH, GAS и ISRE были обнаружены в промоторах Isg15 , Ripk1 и Usp18 соответственно (фиг. 1G). По всему геному пики с мотивами GAS в среднем индуцировались слабее, чем пики с ОБОИМИ мотивами или с мотивами ISRE (рисунок S1C). Восемьдесят семь пиков не имеют ни канонических мотивов GAS, ни ISRE (Рис. 1E), которые могут представлять STAT1, рекрутируемый на хроматин посредством белок-белковых взаимодействий без установления прямых контактов ДНК.Эти пики были удалены из последующих анализов.

Низкая доза IFN-

β активирует ISGF3, но не GAF

Определив, что IFN- β активирует GAF во всем геноме, мы задались вопросом, влияет ли доза IFN- β на активацию GAF. Мы стимулировали клетки с помощью низких (1 Ед / мл) и высоких (10 Ед / мл) доз IFN-β в течение одного часа и выполнили STAT1 ChIP-seq. Мы наблюдали, что при низкой дозе IFN- β ISRE-содержащие области показали индуцируемое связывание STAT1 ( p <2.2 e-16), но не было обнаружено значительного связывания в областях, содержащих GAS (Фигуры 2A, B), как определено категоризацией мотивов на Фигуре 1. Например, GAS-содержащий пик на промоторе Ripk1 связан в дозозависимым образом (рис. 2C), в то время как пики на промоторах Isg15, и Usp18 , которые содержат ОБА и ISRE мотивы, соответственно, индуцируются до одинаковой величины низкой и высокой дозой IFN-β. Это продемонстрировало, что низкие дозы IFN-β индуцируют связывание STAT1 с ISRE, но не с сайтами GAS, предполагая, что GAF может действовать как молекулярный переключатель, чтобы отличать низкие от высоких доз IFN- β .

Рисунок 2 Низкая доза IFN- β предпочтительно активирует ISGF3, а не GAF. (A) Тепловая карта STAT1 ChIP-seq с двумя дозами IFN- β (1 против 10 Ед / мл) в течение 1 часа, показывающая кластеры GAS и ISRE, идентифицированные на рисунке 1F. (B) Коробчатая диаграмма сигналов STAT1 ChIP-seq для пиков кластера GAS в (B) . n.s., не значимо, *** = p <2,2 e-16 по одностороннему критерию ранжированной суммы Уилкокса. (C) Геномный браузер отслеживает репрезентативные пики STAT1 ChIP-seq, связанные с промотором, из «обоих» ( Isg15I ), GAS (Ripk1) и ISRE (Usp18) кластеров в двух дозах IFN- β .

GAF, индуцированный IFN-β, не индуцирует экспрессию соседних генов

Затем мы исследовали функцию событий связывания ISGF3 и GAF путем связывания 636 индуцибельных пиков STAT1 ChIP-seq, идентифицированных на рисунке 1 (принадлежащих ОБА, GAS и Кластеры ISRE) к их ближайшим экспрессируемым генам (рис. 3А). Это дало 543 уникально связанных гена, из которых 181 имели пики промотора STAT1 (от -1000 пар оснований до +100 пар оснований), а 362 имели дистальные пики STAT1. Гены, связанные с пиками в BOTH и ISRE кластерах, показали функциональное обогащение для защитного ответа на вирус и клеточного ответа на термины онтологии гена IFN-β, подтверждая, что это известные ISG.Интересно, однако, что 238 генов, связанных близостью к пикам GAS, не были обогащены какими-либо онтологическими терминами (рисунок S2A).

Рисунок 3 GAF не индуцирует экспрессию близлежащих генов. (A) Схема связывания пиков с генами. Промотор определен как от -1000 до +100 п.н. от TSS. (B) Тепловая карта log2-кратного изменения генов, связанных с пиками STAT1, сгруппированных по мотивам пиков STAT1. Гены упорядочены по расстоянию до пика STAT1. (C) Точечная диаграмма генов в каждой категории, показывающая количество генов выше двукратного порога индукции. (D) Геномный браузер отслеживает репрезентативные пики STAT1 с мотивами GAS на промоторах трех генов. (E) Ответ экспрессии гена на IFN- β (10 Ед / мл) для тех же генов, что и в (D) .

Затем мы исследовали экспрессию 543 связанных генов, выполнив РНК-секвенирование в течение четырехчасового периода времени после стимуляции IFN- β (10 Ед / мл). Кластеризовав гены по категориям мотивов их связанных пиков STAT1 ChIP-seq (фиг. 3B), мы обнаружили, что гены, связанные с кластерами ОБЕИХ и ISRE, индуцировались при стимуляции IFN- β .Величина индукции была самой высокой для генов с пиками промотора STAT1, тогда как дистально связанные гены индуцировались с меньшей вероятностью. Это может быть связано с тем, что энхансеры не обязательно регулируют свои ближайшие гены, и связь между пиком и геном становится все более ненадежной с увеличением геномного расстояния (38, 39).

В отличие от кластеров ОБЕИ и ISRE, мы обнаружили очень небольшую индукцию среди генов, связанных с пиками STAT1 только с мотивами GAS, даже когда события связывания находились в их промоторах (рис. 3B, кластер GAS).Только 4% генов (10 из 238) в кластере GAS были индуцированы более чем в два раза под действием IFN- β по сравнению с 44% и 49% генов в кластерах ОБЕИХ и ISRE, соответственно (рис. 3C). . Например, Fastk , Cuta и Psmd3 все имеют выраженные IFN- β -индуцируемые пики STAT1 в своих промоторах, которые содержат мотивы GAS (фигура 3D). Однако эти гены не проявляли индуцируемого IFN- β изменения уровня экспрессии (фиг. 3E).

Гены, связанные с пиками GAS, также не индуцируются более высокими дозами IFN-β и IFN-γ .Даже при 100 Ед / мл IFN- β и 100 нг / мл IFN- γ только восемь и пять из 238 генов, соответственно, индуцировались более чем в два раза (Фигуры S2B, C). Одним из генов, последовательно индуцируемых стимуляцией IFN, был Irf1 , который был задействован как ключевой фактор в усилении ответов IFN (22, 40). Мы наблюдали, что промотор Irf1 имел пик STAT1 с мотивом GAS (фиг. S3A), и его экспрессия индуцировалась 10 ед / мл IFN- β (фиг. S3B, C). Irf1 , таким образом, может быть важным исключением из общего наблюдения, что связывание GAF не индуцирует экспрессию близлежащих генов.

В макрофагах GAF вызывает экспрессию соседних генов

Учитывая, что IFN- γ играет хорошо описанную роль в функции макрофагов (20), мы задались вопросом, был ли GAF аналогичным образом неактивен в контексте макрофагов. Используя общедоступные наборы данных STAT1, STAT2 и IRF9 ChIP-seq и RNA-seq в макрофагах, происходящих из костного мозга (BMDM) (21), мы провели анализ, идентичный тому, который был проведен в клетках MLE12.В общей сложности 890 пиков STAT1 индуцировались 90-минутной стимуляцией либо IFN- β (200 Ед / мл), либо IFN- γ (10 нг / мл). Они были разделены на 469 пиков, содержащих только мотивы GAS, 38 пиков, содержащих только мотивы ISRE, и 335 пиков, содержащих ОБЕ мотивы (фиг. 4A). Низкое количество пиков STAT1, содержащих ISRE, частично объясняется относительно слабым сигналом STAT1, а также согласуется с предыдущими наблюдениями о том, что многие события связывания ISGF3 в этой системе не зависят от STAT1 (21).Чтобы преодолеть это ограничение, мы использовали альтернативный метод классификации и категоризировали пики BMDM ChIP-seq по типам связывания TF: местоположения с пиками STAT1 и без пиков IRF9 считались событиями связывания GAF, а местоположения с пиками IRF9 в клетках WT и без STAT1 или Пики STAT2 в клетках Irf9 — / — считались событиями связывания ISGF3. Используя этот подход, мы идентифицировали 1281 событие связывания ISGF3 и 677 GAF (Фигуры S4A, B).

Рисунок 4 В макрофагах GAF действительно индуцирует экспрессию близлежащих генов. (A) Тепловая карта данных ChIP-seq в макрофагах (21), классифицированная по присутствию GAS или ISRE-мотива. (B) Схема связывания пиков с генами в макрофагах. Промотор определен как от -1000 до +100 п.н. от TSS. (C) Тепловая карта log2-кратного изменения генов макрофагов, связанных с пиками STAT1 макрофагов. Три повтора 2-часовой стимуляции IFN. Гены упорядочены по расстоянию до пика STAT1. (D) Точечная диаграмма генов в каждой категории, показывающая количество генов макрофагов выше двукратного порога индукции. (E) Гистограмма процентного содержания генов возле пиков, категоризированных по мотивам, которые индуцируются при стимуляции IFN- β , сравнение клеток MLE12 и BMDM.

Затем мы связали пики с ближайшими к ним экспрессируемыми генами, чтобы изучить экспрессию IFN-чувствительных генов для обоих методов категоризации. Используя категоризацию пиков STAT1 на основе мотивов, мы идентифицировали 777 уникально связанных генов (рис. 4В). В отличие от наших наблюдений в клетках MLE12, здесь мы обнаружили, что гены, связанные с пиками GAS, индуцировались таким же образом, как гены, связанные с пиками ISRE или ОБА (рис. 4C), с аналогичными паттернами индукции IFN- β или IFN. — γ стимуляция.Мы обнаружили, что 61,8% генов, связанных с пиками GAS, 66,7% генов, связанных с пиками ISRE, и 70,9% генов, связанных с ОБЕИМИ пиками, индуцировались более чем в два раза (рис. 4D). Альтернативный метод классификации пиков по связыванию TF воспроизвел этот результат: 59,1% генов, связанных со связыванием GAF, и 61,6% генов, связанных с ISGF3, индуцировались более чем в два раза (рисунок S4C).

Эти данные показали, что GAF транскрипционно активен в BMDM, но не в клетках MLE12 (рис. 4E), вероятно, из-за присутствия сотрудничающих TF, которые экспрессируются в макрофагах (41, 42).Действительно, промоторы генов, связанных с пиками GAS, были в 1,9 раза обогащены ( p = 10e-7) мотивами PU.1, фактора транскрипции, специфичного для макрофагов, который взаимодействует с STAT1 в экспрессии генов (42, 43).

Комбинированная активация GAF и ISGF3 усиливает экспрессию ISG в клетках респираторного эпителия

Учитывая неожиданное открытие в эпителиальных клетках, что IFN- β активирует существенное связывание GAF без прямой транскрипционной активности, мы предположили, что GAF может играть косвенную роль. в регулировании ISG.Чтобы обратиться к этой гипотезе, мы сначала определили ISG, используя наши данные РНК-seq для клеток MEL12, стимулированных высокой дозой IFN- β (10 Ед / мл). Мы идентифицировали 179 ISG (рис. 5A) по строгим статистическим пороговым значениям (FDR <0,05 и кратность изменения> 2) и использовали этот набор генов для последующего анализа. Чтобы изучить влияние GAF на экспрессию ISG, мы использовали тот факт, что низкие дозы IFN-β активируют ISGF3, но не GAF (рис. 2), тогда как низкие дозы IFN- γ активируют GAF, но не ISGF3 (рис. 5B).Мы стимулировали клетки низкой дозой IFN-β, низкой дозой IFN- γ , смесью двух и высокой дозой IFN- β , в результате чего модели активации TF показаны на Фигуре 5C. Таким образом, сравнение экспрессии генов в смешанном состоянии и условиях единственного стимула позволило обнаружить гены, которые совместно регулируются ISGF3 и GAF.

Рисунок 5 Комбинированная активация GAF и ISGF3 усиливает экспрессию ISG в клетках респираторного эпителия. (A) Тепловая карта 179 ISG MLE12, определенная индукцией с 10 Ед / мл IFN- β с использованием пороговых значений FDR <0.5 и кратное изменение> 2. (B) EMSA связывания ISRE и GAS в ответ на IFN- β (1 против 100 Ед / мл), IFN- γ (1 против 100 нг / мл) или смесь низких дозы. Типичный гель из пяти повторов. (C) Таблица относительных сил активации ISGF3 и GAF в ответ на различные дозы IFN- β и IFN- γ , основанная на данных EMSA. (D) Анализ основных компонентов ISG в ответ на IFN- β низкая доза (1 Ед / мл), IFN- γ низкая доза (1 нг / мл), IFN- β + IFN- γ низкие дозы («Смешанные») или IFN- β высокие дозы (10 Ед / мл).Четырехчасовая стимуляция в двух повторностях. (E) Тепловая карта ISG, показывающая ответ на низкие дозы IFN- β , низкие дозы IFN- γ и смешанные. Выделены первые три уровня иерархической кластеризации. В аннотациях к строкам указывается оценка улучшения, определенная как RPKM смешанный I (RPKM beta + RPKM gamma ).

Мы выполнили РНК-seq в ответ на условия IFN-β, IFN-γ , смешанные и высокие дозы IFN- β через четыре часа после стимуляции и исследовали экспрессию 179 ранее определенных ISG.Анализ главных компонентов показал, что две повторы смешанного состояния попали между образцами IFN-β и IFN-γ и были размещены дальше от нестимулированного образца по сравнению с условиями одиночного стимула (фиг. 5D). Это свидетельствует о том, что смешанное состояние привело к профилю экспрессии гена, который представляет собой гибрид профилей IFN-β и IFN- γ , и что некоторые ISG индуцировались сильнее в смешанном состоянии.

Визуализация этих ISG в иерархически сгруппированной тепловой карте дала дополнительное понимание эффектов GAF и ISGF3 (рис. 5E).Мы наблюдали, что ISG в верхнем кластере (C1) индуцировались одним IFN- γ , и их экспрессия лишь слегка усиливалась в смешанном состоянии. Точно так же гены в нижнем кластере (C3) индуцировались одним IFN- β и слегка усиливались в смешанном состоянии.

Наибольший интерес представляла экспрессия ISG в среднем кластере (C2). Эти ISG слабо индуцировались в ответ либо на IFN- β , либо только на IFN- γ , но сильно усиливались в смешанном состоянии.Чтобы количественно оценить эффект от смешивания IFN- β и IFN- γ , мы рассчитали балл улучшения для каждого гена: балл улучшения = RPKM смешанный / (RPKM β + RPKM γ ) (Аннотация на рис. 5E). Эта объективная оценка подтвердила, что многие гены в среднем кластере сильно усиливаются в смешанном состоянии, предполагая, что ISGF3 и GAF могут совместно регулировать экспрессию некоторых ISG.

Чтобы исследовать свойства сильно усиленных генов, мы сравнили ISG в верхнем квартиле оценки улучшения (n = 45, улучшение> 1.156) до ISG в нижнем квартиле (n = 45, улучшение <0,774)) (рис. 6А). Чтобы подтвердить, что повышенная экспрессия генов произошла в течение нескольких временных точек, мы выполнили РНК-секвенирование в течение шестичасового периода. Гены в верхнем квартиле действительно демонстрировали образец усиления в нескольких временных точках, а степень индуцибельности в смешанном состоянии приближалась к той, которая наблюдалась при высокой дозе IFN- β (фиг. 6B). Мы также заметили, что гены в верхней категории индуцировались более устойчиво, чем гены в нижней категории для всех условий (рисунки 6B, C).Это произошло в первую очередь из-за того, что гены в верхней категории имели гораздо более низкую базальную экспрессию, чем гены в нижней категории (рис. 6C, p = 2,66 e-15 для разницы между базальными RPKM).

Рисунок 6 Свойства сильно улучшенных ISG. (A) График плотности, показывающий распределение баллов улучшения (ES) по 179 ISG. Гены из верхнего квартиля (ES> 1,156) и нижнего квартиля (ES <0,774) заштрихованы (n = 45 генов каждый). (B) Тепловая карта генов верхнего и нижнего квартилей в динамике стимуляции IFN- β low, IFN- γ high, Mixed и IFN- β high (10 Ед / мл). (C) Коробчатые диаграммы абсолютной экспрессии гена в Log 2 RPKM для верхних и нижних генов усиления стимулом. (D) Коробчатая диаграмма содержания GC при TSS (от -300 до + 300 пар оснований) верхних по сравнению с нижними генами усиления. (E) Процент верхних по сравнению с нижними генами усиления, которые имеют пик STAT1ChiP-seq в промоторе (от -1000 пар оснований до +100 пар оснований). (F) Коробчатые диаграммы индуцибельной экспрессии верхних и нижних генов усиления в ответ на высокие дозы IFN- β (10 и 100 Ед / мл). (G) Линейные графики репрезентативных генов Top (Cxcl10, lfit1) против Оценка нижнего улучшения (Tor1aip1) .

Мы подтвердили, что гены в высшей категории также были значительно более индуцируемыми в ответ на высокие дозы IFN-β (10 и 100 Ед / мл, рис. 6D), предполагая, что оценка улучшения в нашем эксперименте по смешиванию предсказывает ответы экспрессии генов в высоких дозах IFN-β, которые активируют как GAF, так и ISGF3.

Предыдущие исследования показали, что содержание GC антикоррелирует со стабильностью нуклеосом и что гены с высоким содержанием GC в их промоторах экспрессируются конститутивно, потому что им не требуется ремоделирование нуклеосом для активации транскрипции (44, 45).Мы подсчитали содержание GC в промоторах (от -300 до + 300 пн) генов оценки улучшения Top vs. Bottom и обнаружили, что промоторы генов нижней категории показали значительно более высокое содержание GC по сравнению с промоторами генов верхней категории ( p = 0,0001, Рисунок 6E). Мы также обнаружили, что 25 из 45 (56%) генов в верхнем квартиле улучшения имели пики STAT1 ChIP-seq в своих промоторах (от -1000 пар оснований до +100 пар оснований) в любой момент времени, по сравнению только с 10 из 45 (22%). гены в нижнем квартиле ( p = 0.002, фиг. 6F). Эти находки подтверждают идею о том, что гены, наиболее сильно усиленные комбинированной активацией ISGF3 и GAF, не экспрессируются конститутивно, но требуют индуцибельного связывания ТФ на их промоторах, чтобы установить хроматиновую среду, которая допускает максимальную экспрессию.

Гены в верхнем квартиле оценки улучшения включали провоспалительный цитокин Cxcl10 (оценка улучшения = 2,25) и противовирусный эффектор Ifit1 (оценка улучшения = 2,24), оба из которых демонстрируют низкую базальную экспрессию и наибольшую индуцируемость в Смешанное состояние (Фиг.6G).Напротив, Tor1aip1 был представителем генов в нижнем квартиле с относительно высокой экспрессией в базальном состоянии (19 RPKM) и умеренной индуцибельностью, которая была аналогичной для одного IFN- β и смешанного состояния. Полный список генов верхнего и нижнего квартилей представлен в таблице S1. Анализ мотивов TF и ​​анализ генной онтологии не выявили различий между этими двумя категориями. Оба гена Top и Bottom содержали мотивы ISRE в своих промоторах и были обогащены терминами онтологии, относящимися к IFN, такими как «вирусная защита» и «иммунный ответ» (данные не показаны).

Геноспецифические механизмы усиления ISG, опосредованного GAF

Если связывание GAF не вызывает непосредственно экспрессию соседних генов, но смешивание IFN- β и IFN- γ усиливает экспрессию ISG, мы пришли к выводу, что должно быть косвенные механизмы, с помощью которых GAF взаимодействует с ISGF3. Одним из возможных механизмов является то, что GAF и ISGF3 могут работать совместно на промоторах усиленных генов (фиг. 7A), где GAF может либо рекрутировать общие TF, либо увеличивать доступность хроматина для облегчения связывания ISGF3.В соответствии с этим, гены с пиками промотора STAT1, содержащими ОБОИХ мотивов, имели более высокие оценки усиления по сравнению с генами с пиками промотора STAT1, содержащими только мотивы ISRE (фиг. 7B), что подразумевает, что комбинаторное связывание GAF и ISGF3 на ОБЕИХ пиках может усиливать экспрессию генов. Например, Mx2 имеет два различных пика STAT1 в своем промоторе, один из которых имеет ОБЕИМ мотивы, и он имеет оценку усиления 1,23 (рис. 7C).

Рисунок 7 Ген-специфические механизмы усиления GAF. (A) Схема GAF и ISGF3, совместно локализованных на промоторах для усиления экспрессии ISG. (B) Скрипочные графики оценок усиления для генов с пиками промотора STAT1, содержащими ОБА мотивов (GAS + ISRE) по сравнению с только мотивом ISRE. (C) STAT1 ChIP-seq отслеживает промотор Mx2 , который имеет ОБА пик в проксимальном промоторе, а также пик ISRE на TSS. (D) Схема дистальной петли связывания GAF с промоторами ISG для усиления экспрессии ISG. (E) График плотности расстояния от всех пиков STAT1 до ближайшего TSS, разделенных категорией пикового мотива. (F) Геномный браузер отслеживает данные STAT1 ChIP-seq и данные Hi-C (46) в локусе Cxcl10 , демонстрируя контакт двух ОБЕИХ пиков с TSS.

Второй возможный механизм заключается в том, что GAF может связываться с дистальными энхансерами ISGs (Figure 7D). Пики GAS были распределены дальше от аннотированных генов, чем пики ОБЕИ или ISRE (рис. 7E), а ближайшие к GAS гены не были обогащены терминами онтологии, относящимися к IFN (рис. S2A).Это свидетельствует о том, что GAF связывается преимущественно в межгенных регионах, функционирующих как дистальные энхансеры, а не как промоторы. Чтобы исследовать эту гипотезу, мы изучили данные Hi-C (Pc-HiC) захвата промотора из эмбриональных стволовых клеток мыши (46). Полногеномный анализ этих данных Pc-HiC не выявил значительных различий между генами Top и Bottom Enhancement Score, вероятно, из-за того факта, что энхансеры в высокой степени специфичны к типу клеток (47). Однако мы обнаружили, что промотор Cxcl10 , гена с высокой оценкой усиления, устанавливает статистически значимые контакты Hi-C с тремя соседними пиками STAT1, два из которых содержат ОБОИ мотивы, а один — мотив ISRE (рис. 7F).

Обсуждение

Скоординированная активация как ISGF3, так и GAF в ответ на стимуляцию IFN- β наблюдалась ранее, но функция GAF в этом контексте оставалась неясной. Мы обнаружили, что активация GAF происходит только при высоких дозах IFN- β , тогда как низкие дозы IFN-β активируют только ISGF3, но не GAF. Неожиданно связывание STAT1 с сайтами GAS было недостаточным для индукции экспрессии гена в клетках MLE12, но не в BMDM. Несмотря на отсутствие GAF-опосредованной транскрипции, мы наблюдали, что стимуляция клеток MLE12 низкими дозами IFN-β и IFN-γ вместе, что повторяет скоординированную активацию ISGF3 и GAF высокими дозами IFN-β, усиливает экспрессию ISG. по сравнению с любым стимулом в одиночку.Мы утверждаем, что GAF усиливает экспрессию ISG посредством ряда специфичных для генов механизмов, которые увеличивают потенциал активации ISGF3.

Наше открытие, что IFN- β активирует GAF дозозависимым образом, имеет важные последствия для иммунитета и воспаления. Низкие уровни тонического IFN- β поддерживают гомеостаз во многих тканях и обеспечивают базальную степень противовирусной защиты (48–51). Наше исследование предполагает, что в тонических условиях IFN- β экспрессия ISG ограничена низким уровнем в отсутствие GAF.Однако в контексте активной инфекции концентрация IFN- β в микроокружении увеличивается, а также продуцируется IFN- γ . Повышенные уровни IFN- β и IFN- γ активируют GAF, который действует как молекулярный переключатель для усиления экспрессии для подмножества ISG. Эти улучшенные ISG включают противовирусные медиаторы, такие как Ifit1 , а также провоспалительные хемокины, такие как Cxcl10 (рис. 6G). Отсутствие GAF в тонических условиях IFN- β может, таким образом, ограничивать экспрессию провоспалительных генов, которые могут быть вредными в гомеостатических условиях.Мы предлагаем модель, в которой ISG делятся на два класса: те, которые не зависят от GAF и слабо индуцируются даже при высоких дозах IFN- β , и те, которые усиливаются при активации GAF (Рисунок S5). Таким образом, ось IFN- β -GAF регулирует выход подгруппы ISG дозозависимым образом для ограничения воспаления при гомеостазе, но способствует экспрессии как противовирусных, так и провоспалительных генов в ответ на патогены.

Поразительный вывод нашего исследования состоял в том, что связывание STAT1 с элементами GAS недостаточно для активации экспрессии генов в клетках MLE12.Гены, связанные с событиями связывания GAF, не индуцировались в ответ на высокие дозы IFN- β или IFN- γ , даже если события связывания происходили в их промоторах (фиг. 3 и фиг. S2). Напротив, используя идентичный анализ BMDM, мы обнаружили, что связывание GAF связано с экспрессией близлежащих генов в макрофагах. Вероятным объяснением специфичности этого типа клеток является наличие взаимодействующих TF, которые более многочисленны или базально связаны в макрофагах, таких как IRF1, IRF8 и / или PU.1 (42), тем самым обеспечивая хроматиновую среду, которая лучше облегчает транскрипцию.

Наши находки предполагают, что в определенных контекстах одного только GAF недостаточно для активации транскрипции. Это было предложено другими, и есть две вероятные причины, почему это может быть правдой. Во-первых, существуют две изоформы STAT1: полноразмерный STAT1α и более короткий STAT1 β , в котором отсутствует остаток S727, необходимый для максимальной транскрипционной активности (52–54). STAT1 β плохо взаимодействует с коактиваторами транскрипции, такими как CBP / p300, и, таким образом, имеет пониженную транскрипционную активность по сравнению со STAT1 α (55–57).Было высказано предположение, что STAT1 α преимущественно образует комплексы ISGF3, тогда как менее активный STAT1 β образует комплексы GAF (52). Во-вторых, для трансактивации STAT1 необходимы посттрансляционные модификации. Нефосфорилированный STAT1 может участвовать в транскрипции как часть комплекса ISGF3 (56, 58) благодаря трансактивационной активности STAT2. Но как гомодимер, фосфорилирование S727 необходимо для транскрипционной активности STAT1 (56). Будущие эксперименты с ChIP с использованием антител против предполагаемых сотрудничающих TF или различных изоформ STAT1 и состояний фосфорилирования прольют свет на эти предполагаемые механизмы.

Несмотря на свою неспособность напрямую активировать экспрессию генов в эпителиальных клетках, GAF усиливает экспрессию ISG в клетках MLE12. GAF может синергетически сотрудничать с ISGF3 для индукции максимальной экспрессии гена либо путем совместной локализации на промоторах, либо когда дистально связанный GAF взаимодействует с связанным с промотором ISGF3 посредством образования петель хромосом. Поскольку сам по себе GAF транскрипционно неактивен, мы предполагаем, что GAF может модулировать хроматиновую среду для облегчения связывания и трансактивации ISGF3.STAT1 выполняет четко определенную эпигенетическую роль ниже IFN- γ в макрофагах, прививая гены для большей реакции на другие TF, такие как NFκB, путем модуляции окружения хроматина (20, 59–61). Подобный механизм, хотя и в более коротком временном масштабе, может лежать в основе усиления GAF ISGF3 в ответ на высокие дозы IFN- β . Интересно то, что наши данные о динамике ChIP-seq показывают, что активность GAF достигает пика раньше, чем ISGF3, предполагая, что GAF может связываться первым, изменяя состояния хроматина и облегчая последующее связывание ISGF3 и устойчивую индукцию ISG.

Мы также обнаружили, что в клетках MLE12 IRF1 был одним из восьми индуцибельных генов IFN- β с GAS-содержащим пиком STAT1 в его промоторе. В клеточных линиях гепатоцитов человека и органоидах кишечника IRF1 индуцируется IFN- γ и высокими дозами IFN- β (25 Ед / мл), и он необходим для максимальной экспрессии ISG, включая Cxcl10 (22). . Наши результаты предполагают механистическую парадигму в эпителиальных клетках, где IFN- β активирует GAF, который затем индуцирует IRF1 для усиления экспрессии подмножества ISG.В самом деле, IRF1 может быть одним из немногих генов, которые являются прямой мишенью для GAF. Таким образом, ось GAF-IRF1 может быть аналогична оси IRF3-ISGF3, где вторичный TF является более мощным активатором экспрессии генов, чем первичный TF, основная роль которого заключается в индукции вторичного TF (16).

Наше исследование демонстрирует, что IFN- β активирует GAF дозозависимым образом, который взаимодействует с ISGF3 для усиления экспрессии ISG в клетках MLE12. Эти результаты продвигают наше понимание регуляции передачи сигналов IFN типа I, одновременно поднимая ряд вопросов, требующих дальнейшего изучения.Неясно, наблюдаются ли эти механизмы в других типах эпителиальных клеток, включая первичные клетки. Дальнейшее исследование роли IRF1 или эпигенетических изменений, индуцированных связыванием GAF, может включать генетические пертурбации или измерения доступности хроматина и модификаций гистонов в сайтах связывания GAF. Наконец, физиологическая роль GAF в ответе на IFN- β может быть исследована с использованием in vivo моделей инфекции , в которых его скоординированная активация нарушена.

Заявление о доступности данных

Наборы данных, представленные в этом исследовании, можно найти в онлайн-репозиториях. Названия репозитория / репозиториев и номера доступа можно найти ниже: https://www.ncbi.nlm.nih.gov/geo/, GSE161475.

Вклад авторов

Эксперименты проводились KK, CW, JB и QC. KK, MN, CO и QC проанализировали данные. KK и QC написали рукопись. Исследование было задумано AH и QC. AH получила финансирование для исследования. Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Работа финансировалась грантом NIH (AH) R01AI132835. KK, MN и CO были профинансированы программой UCLA Bruins in Genomics Undergraduate Research Program. CW был поддержан премией Национальной исследовательской службы Рут Л. Киршштейн AI007323 и постдокторской стипендией Канцлера Калифорнийского университета в Лос-Анджелесе. JB был поддержан Фондом Ирвинга и Джин Стоун и премией Оппенгеймера программы стипендиатов бакалавриата Калифорнийского университета в Лос-Анджелесе. Контроль качества проводился при поддержке Программы специальной подготовки и перспективных исследований Департамента медицины Калифорнийского университета в Лос-Анджелесе.

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fimmu.2021.651254/full#supplementary-material

Ссылки

2. Stegemann- Конишевский С., Джерон А., Гереке М., Гефферс Р., Крегер А., Гунцер М. и др.Эпителиальные клетки альвеолярного типа II вносят вклад в антигриппозный ответ вируса гриппа А в легких, интегрируя сигналы, полученные от патогенов и микросреды. mBio (2016) 7 (3): e00276–16. DOI: 10.1128 / mBio.00276-16

PubMed Аннотация | CrossRef Полный текст | Google Scholar

3. Торли AJ, Ford PA, Giembycz MA, Goldstraw P, Young A, Tetley TD. Дифференциальная регуляция высвобождения цитокинов и миграции лейкоцитов с помощью стимулированных липополисахаридами первичных эпителиальных клеток альвеолярного типа II легких человека и макрофагов. J Immunol (2007) 178: 463–73. doi: 10.4049 / jimmunol.178.1.463

PubMed Аннотация | CrossRef Полный текст | Google Scholar

4. Чукимия О.Д., Петурсдоттир Д.Х., Периоло Н., Фернандес С. Клетки альвеолярного эпителия имеют решающее значение для защиты дыхательных путей за счет секреции факторов, способных модулировать активность легочных макрофагов и напрямую контролировать рост бактерий. Infect Immun (2013) 81: 381–9. doi: 10.1128 / IAI.00950-12

PubMed Аннотация | CrossRef Полный текст | Google Scholar

5.Шнайдер ВМ, Шевиллотт МД, Райс СМ. Гены, стимулированные интерфероном: сложная сеть защитных механизмов хозяина. Annu Rev Immunol (2014) 32: 513–45. doi: 10.1146 / annurev -munol-032713-120231

PubMed Реферат | CrossRef Полный текст | Google Scholar

6. Лейва-Хуарес М.М., Коллс Дж. К., Эванс С. Е.. Эпителиальные клетки легких: терапевтически индуцируемые эффекторы противомикробной защиты. Mucosal Immunol (2018) 11: 21–34. DOI: 10,1038 / mi.2017.71

PubMed Аннотация | CrossRef Полный текст | Google Scholar

9.Вайро Д., Тассоне Л., Табеллини Дж., Тамассия Н., Гасперини С., Баццони Ф. и др. Серьезное нарушение ответов IFN-γ и IFN-α в клетках пациента с новой мутацией сплайсинга STAT1. Кровь (2011) 118: 1806–17. doi: 10.1182 / blood-2011-01-330571

PubMed Аннотация | CrossRef Полный текст | Google Scholar

10. Hambleton S, Goodbourn S, Young DF, Dickinson P, Mohamad SMB, Valappil M, et al. Дефицит STAT2 и восприимчивость к вирусным заболеваниям у людей. Proc Natl Acad Sci U S. A (2013) 110: 3053–8.DOI: 10.1073 / pnas.1220098110

PubMed Аннотация | CrossRef Полный текст | Google Scholar

11. Hoyos-Bachiloglu R, Chou J, Sodroski CN, Beano A, Bainter W., Angelova M, et al. Дигенный иммунодефицит человека, характеризующийся мутациями IFNAR1 и IFNGR2. Дж. Клин Инвест (2017) 127: 4415–20. doi: 10.1172 / JCI93486

PubMed Аннотация | CrossRef Полный текст | Google Scholar

12. Бегитт А., Дрэшер М., Мейер Т., Шмид С.Д., Бейкер М., Антунес Ф. и др. Связывание STAT1-кооперативной ДНК отличает передачу сигналов интерферона типа 1 от типа 2. Nat Immunol (2014) 15: 168–76. doi: 10.1038 / ni.2794

PubMed Аннотация | CrossRef Полный текст | Google Scholar

13. Barrat FJ, Crow MK, Ivashkiv LB. Экспрессия гена-мишени интерферона и эпигеномные сигнатуры в здоровье и болезни. Nat Immunol (2019) 20: 1574–83. DOI: 10.1038 / s41590-019-0466-2

PubMed Аннотация | CrossRef Полный текст | Google Scholar

16. Уртиага Д. Р., Бирнбаум Х., Ортенлоф Н., Варгас Дж. Д., Воллман Р., Хоффманн А. Ограниченная специфичность IRF3 и ISGF3 в транскрипционном врожденном иммунном ответе на двухцепочечную РНК. J Leukoc Biol (2015) 98: 119–28. doi: 10.1189 / jlb.4a1014-483rr

PubMed Аннотация | CrossRef Полный текст | Google Scholar

17. Шуай К., Хорват CM, Хуанг Л. Х., Куреши С. А., Ковберн Д., Дарнелл Дж. Э. Активация интерфероном фактора транскрипции Stat91 включает димеризацию посредством взаимодействий Sh3-фосфотирозилпептида. Cell (1994) 76: 821–8. doi: 10.1016 / 0092-8674 (94) -3

PubMed Аннотация | CrossRef Полный текст | Google Scholar

18.Декер Т., Лью DJ, Миркович Дж, Дарнелл Дж. Цитоплазматическая активация GAF, фактора связывания ДНК, регулируемого IFN-гамма. EMBO J (1991) 10: 927–32. doi: 10.1002 / j.1460-2075.1991.tb08026.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

19. Декер Т., Коварик П., Мейнке А. Элементы ГАЗ: несколько нуклеотидов, оказывающих большое влияние на экспрессию генов, индуцированную цитокинами. J Interferon Cytokine Res (1997) 17: 121–34. DOI: 10.1089 / jir.1997.17.121

PubMed Аннотация | CrossRef Полный текст | Google Scholar

20.Ивашкив Л.Б. IFNγ: передача сигналов, эпигенетика и роль в иммунитете, метаболизме, иммунотерапии болезней и рака. Nat Rev Immunol (2018) 18: 545–58. doi: 10.1038 / s41577-018-0029-z

PubMed Аннотация | CrossRef Полный текст | Google Scholar

21. Platanitis E, Demiroz D, Schneller A, Fischer K, Capelle C, Hartl M, et al. Молекулярный переход от STAT2-IRF9 к ISGF3 лежит в основе индуцированной интерфероном транскрипции генов. Нац Коммуна (2019) 10: 2921. doi: 10.1038 / s41467-019-10970-y

PubMed Аннотация | CrossRef Полный текст | Google Scholar

22.Forero A, Ozarkar S, Li H, Lee CH, Hemann EA, Nadjsombati MS, et al. Дифференциальная активация фактора транскрипции IRF1 лежит в основе различных иммунных ответов, вызываемых интерферонами типа I и типа III. Иммунитет (2019) 51: 451–64.e6. doi: 10.1016 / j.immuni.2019.07.007

PubMed Аннотация | CrossRef Полный текст | Google Scholar

23. Raza S, Barnett MW, Barnett-Itzhaki Z, Amit I., Hume DA, Freeman TC. Анализ транскрипционных сетей, лежащих в основе активации макрофагов мышей медиаторами воспаления. J Leukoc Biol (2014) 96: 167–83. doi: 10.1189 / jlb.6HI0313-169R

PubMed Аннотация | CrossRef Полный текст | Google Scholar

24. Waddell SJ, Popper SJ, Rubins KH, Griffiths MJ, Brown PO, Levin M, et al. Рассмотрение индуцированных интерфероном программ транскрипции в клетках периферической крови человека. PloS One (2010) 5: e9753. doi: 10.1371 / journal.pone.0009753

PubMed Аннотация | CrossRef Полный текст | Google Scholar

25. Мартин М. Кутадапт удаляет последовательности адаптеров из операций чтения с высокой пропускной способностью. EMBnet J (2011) 17:10. doi: 10.14806 / ej.17.1.200

CrossRef Полный текст | Google Scholar

28. Рамирес Ф., Дюндар Ф., Диль С., Грюнинг Б.А., Манке Т. DeepTools: гибкая платформа для исследования данных глубокого секвенирования. Nucleic Acids Res (2014) 42: W160–5. doi: 10.1093 / nar / gku365

CrossRef Полный текст | Google Scholar

29. Heinz S, Benner C, Spann N, Bertolino E, Lin YC, Laslo P, et al. Простые комбинации факторов транскрипции, определяющих клонирование, активируют цис-регуляторные элементы, необходимые для идентичности макрофагов и В-клеток. Mol Cell (2010) 38: 576–89. doi: 10.1016 / j.molcel.2010.05.004

PubMed Аннотация | CrossRef Полный текст | Google Scholar

32. Декер Т., Лью Д. Д., Дарнелл Дж. Э. Два различных пути передачи сигнала, зависимые от альфа-интерферона, могут способствовать активации транскрипции гена гуанилат-связывающего белка. Mol Cell Biol (1991) 11: 5147–53. doi: 10.1128 / mcb.11.10.5147

PubMed Аннотация | CrossRef Полный текст | Google Scholar

33.Добин А., Дэвис К.А., Шлезингер Ф., Дренкоу Дж., Залески С., Джа С. и др. STAR: сверхбыстрый универсальный выравниватель RNA-seq. Биоинформатика (2013) 29: 15–21. doi: 10.1093 / биоинформатика / bts635

PubMed Аннотация | CrossRef Полный текст | Google Scholar

34. Liao Y, Smyth GK, Shi W. featureCounts: эффективная программа общего назначения для сопоставления считываний последовательностей с геномными функциями. Биоинформатика (2014) 30: 923–30. DOI: 10.1093 / биоинформатика / btt656

PubMed Аннотация | CrossRef Полный текст | Google Scholar

35.Робинсон, доктор медицины, Маккарти, ди-джей, Смит, Г.К. edgeR: пакет Bioconductor для анализа дифференциальной экспрессии цифровых данных экспрессии генов. Биоинформатика (2009) 26: 139–40. doi: 10.1093 / биоинформатика / btp616

PubMed Аннотация | CrossRef Полный текст | Google Scholar

36. Хуанг Д.В., Шерман Б.Т., Тан К., Коллинз Дж. Р., Элворд В. Г., Ройай Дж. И др. Инструмент функциональной классификации генов DAVID: новый алгоритм, ориентированный на биологические модули, для функционального анализа больших списков генов. Genome Biol (2007) 8. doi: 10.1186 / gb-2007-8-9-r183

PubMed Реферат | CrossRef Полный текст | Google Scholar

37. Wickham H. ggplot2 — Элегантная графика для анализа данных. Нью-Йорк: Springer-Verlag (2016). 276 с.

Google Scholar

38. Corces MR, Granja JM, Shams S, Louie BH, Seoane JA, Zhou W и др. Пейзаж доступности хроматина при первичном раке человека. Наука (2018) 362: eaav1898. doi: 10.1126 / science.aav1898

PubMed Аннотация | CrossRef Полный текст | Google Scholar

39.Fulco CP, Nasser J, Jones TR, Munson G, Bergman DT, Subramanian V и др. Контактная модель регуляции энхансер-промотор от тысяч нарушений CRISPR. Нат Генет (2019) 51: 1664–9. doi: 10.1038 / s41588-019-0538-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

40. Haque SJ, Williams BR. Идентификация и характеристика стимулированного интерфероном (IFN) ответного элемента-IFN-стимулированного гена, независимого от фактора 3, сигнального пути для IFN-альфа. J Biol Chem (1994) 269: 19523–9.

PubMed Аннотация | Google Scholar

41. Langlais D, Barreiro LB, Gros P. Регулом макрофага IRF8 / IRF1 необходим для защиты от инфекций и связан с хроническим воспалением. J Exp Med (2016) 213: 585–603. doi: 10.1084 / jem.20151764

PubMed Аннотация | CrossRef Полный текст | Google Scholar

43. Aittomäki S, Yang J, Scott EW, Simon MC, Silvennoinen O. Молекулярные основы Stat1 и PU.1 кооперация в цитокин-индуцированной активации промотора рецептора I Fcgamma. Int Immunol (2004) 16: 265–74. doi: 10.1093 / intimm / dxh037

PubMed Аннотация | CrossRef Полный текст | Google Scholar

44. Ramirez-Carrozzi VR, Braas D, Bhatt DM, Cheng CS, Hong C, Doty KR, et al. Унифицирующая модель для селективной регуляции индуцибельной транскрипции с помощью CpG-островков и ремоделирования нуклеосом. Cell (2009) 138: 114–28. doi: 10.1016 / j.cell.2009.04.020

PubMed Аннотация | CrossRef Полный текст | Google Scholar

45.Смейл С.Т., Тараховский А., Натоли Г. Вклад хроматина в регуляцию врожденного иммунитета. Annu Rev Immunol (2014) 32: 489–511. doi: 10.1146 / annurev -munol-031210-101303

PubMed Реферат | CrossRef Полный текст | Google Scholar

46. Шонфельдер С., Мифсуд Б., Сеннер С.Э., Тодд С.Д., Хрисанту С., Дарбо Е. и др. Дивергентное соединение репрессивных и активных взаимодействий хроматина между клонами эмбрионов мыши и трофобластов. Nat Commun (2018) 9: 1–10.doi: 10.1038 / s41467-018-06666-4

PubMed Аннотация | CrossRef Полный текст | Google Scholar

47. Хайнцман Н.Д., Хон Г.К., Хокинс Р.Д., Керадпур П., Старк А., Харп Л.Ф. и др. Модификации гистонов в энхансерах человека отражают глобальную экспрессию генов, специфичных для клеточного типа. Nature (2009) 459: 108–12. DOI: 10.1038 / nature07829

PubMed Аннотация | CrossRef Полный текст | Google Scholar

48. Bradley KC, Finsterbusch K, Schnepf D, Fuchs SY, Staeheli P, Wack A, et al.Управляемые микробиотой тонические сигналы интерферона в стромальных клетках легких защищают от инфекции вирусом гриппа. Cell Rep (2019) 28: 245–56. doi: 10.1016 / j.celrep.2019.05.105

PubMed Аннотация | CrossRef Полный текст | Google Scholar

49. Gough DJ, Messina NL, Clarke CJP, Johnstone RW, Levy DE. Конститутивный интерферон I типа модулирует гомеостатический баланс посредством тонической передачи сигналов. Иммунитет (2012) 36: 166–74. doi: 10.1016 / j.immuni.2012.01.011

PubMed Аннотация | CrossRef Полный текст | Google Scholar

51.Стид А.Л., Кристофи Г.П., Кайко Г.Е., Сан Л., Гудвин В.М., Джайн У. и др. Микробный метаболит дезаминотирозин защищает от гриппа с помощью интерферона I типа. Наука (2017) 357: 498–502. doi: 10.1126 / science.aam5336

PubMed Аннотация | CrossRef Полный текст | Google Scholar

52. Мюллер М., Лакстон К., Бриско Дж., Шиндлер К., Импрота Т., Дарнелл Дж. Э. и др. Комплементация мутантной клеточной линии: центральная роль полипептида 91 кДа ISGF3 в путях передачи сигналов интерферона-альфа и гамма. EMBO J (1993) 12: 4221–8.

PubMed Аннотация | Google Scholar

53. Шиндлер C, Fu XY, Improta T, Aebersold R, Darnell JE. Белки фактора транскрипции ISGF-3: один ген кодирует 91- и 84-кДа белки ISGF-3, которые активируются интерфероном альфа. Proc Natl Acad Sci (1992) 89: 7836–9. doi: 10.1073 / pnas.89.16.7836

PubMed Аннотация | CrossRef Полный текст | Google Scholar

54. Вариноу Л., Рамзауэр К., Карагиософф М., Кольбе Т., Пфеффер К., Мюллер М. и др.Фосфорилирование домена трансактивации Stat1 необходимо для полноценного IFN-γ-зависимого врожденного иммунитета. Иммунитет (2003) 19: 793–802. DOI: 10.1016 / S1074-7613 (03) 00322-4

PubMed Реферат | CrossRef Полный текст | Google Scholar

55. Рамзауэр К., Фарлик М., Зупковиц Г., Зайзер С., Крегер А., Хаузер Х и др. Определенные способы действия, применяемые факторами транскрипции STAT1 и IRF1 для инициации транскрипции IFN-γ-индуцибельного гена gbp2. Proc Natl Acad Sci U S. A (2007) 104: 2849–54.DOI: 10.1073 / pnas.0610944104

PubMed Аннотация | CrossRef Полный текст | Google Scholar

56. Sadzak I, Schiff M, Gattermeier I, Glinitzer R, Sauer I, Saalmüller A, et al. Рекрутирование Stat1 в хроматин необходимо для индуцированного интерфероном фосфорилирования серина домена трансактивации Stat1. Proc Natl Acad Sci U S. A (2008) 105: 8944–9. doi: 10.1073 / pnas.0801794105

PubMed Аннотация | CrossRef Полный текст | Google Scholar

57. Захарова Н., Лымар Е.С., Ян Э., Малик С., Чжан Дж.Дж., Рёдер Р.Г. и др.Определенные функции активации транскрипции STAT1α и STAT1β на матрицах ДНК и хроматина. J Biol Chem (2003) 278: 43067–73. doi: 10.1074 / jbc.M308166200

PubMed Аннотация | CrossRef Полный текст | Google Scholar

58. Семпер С., Лейтнер Н.Р., Лассниг С., Паррини М., Махлаков Т., Раммерсторфер М. и др. STAT1 не является доминантно-отрицательным и способен способствовать развитию врожденного иммунитета, зависимого от гамма-интерферона. Mol Cell Biol (2014) 34: 2235–48. DOI: 10.1128 / mcb.00295-14

PubMed Аннотация | CrossRef Полный текст | Google Scholar

59. Cheng Q, Behzadi F, Sen S, Ohta S, Spreafico R, Teles R, et al. Последовательная кондиционирующая стимуляция выявляет различные специфичные для генов и стимулов эффекты IFN типа I и II на функции макрофагов человека. Sci Rep (2019) 9: 5288. doi: 10.1038 / s41598-019-40503-y

PubMed Аннотация | CrossRef Полный текст | Google Scholar

60. Остуни Р., Пикколо В., Бароцци И., Поллетти С., Терманини А., Бонифачо С. и др.Скрытые энхансеры активируются при стимуляции дифференцированных клеток. Cell (2013) 152: 157–71. doi: 10.1016 / j.cell.2012.12.018

PubMed Аннотация | CrossRef Полный текст | Google Scholar

61. Цяо Ю., Джаннопулу Е.Г., Чан С.Х., Парк С.Х., Гонг С., Чен Дж. И др. Синергетическая активация генов воспалительных цитокинов за счет индуцированного интерфероном-γ ремоделирования хроматина и передачи сигналов толл-подобных рецепторов. Иммунитет (2013) 39: 454–69. doi: 10.1016 / j.immuni.2013.08.009

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Передача сигналов IFN и транскрипционные сигнатуры дегрануляции нейтрофилов индуцируются во время инфекции SARS-CoV-2

  • 1.

    Huang, C. et al. Клинические особенности пациентов, инфицированных новым коронавирусом 2019 г., в Ухане, Китай. Ланцет 395 , 497–506 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 2.

    Xu, Z. et al. Патологические данные COVID-19, связанные с острым респираторным дистресс-синдромом. Lancet Respiratory Med. 8 , 420–422 (2020).

    CAS Статья Google Scholar

  • 3.

    Тай, М. З., По, К. М., Рения, Л., Макари, П. А. и Нг, Л. Ф. П. Троица COVID-19: иммунитет, воспаление и вмешательство. Nat. Ред. Immunol . https://doi.org/10.1038/s41577-020-0311-8 (2020).

  • 4.

    Вабрет Н. и др. Синайский проект по обзору иммунологии. Иммунология COVID-19: современное состояние науки. Иммунитет https://doi.org/10.1016/j.immuni.2020.05.002 (2020).

  • 5.

    Monaco, G. et al. Сигнатуры РНК-Seq, нормализованные по количеству мРНК, позволяют осуществить абсолютную деконволюцию типов иммунных клеток человека. Cell Rep. 26 , 1627–1640.e1627 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 6.

    Wilson, J. A. et al. РНК-Seq анализ инфекции вирусом чикунгунья и идентификация гранзима А как основного промотора артритного воспаления. PLoS Pathog. 13 , e1006155 (2017).

    PubMed PubMed Central Статья CAS Google Scholar

  • 7.

    Xiong, Y. et al. Транскриптомные характеристики жидкости бронхоальвеолярного лаважа и мононуклеарных клеток периферической крови у пациентов с COVID-19. Emerg. Микробы заражают. 9 , 761–770 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 8.

    Bost, P. et al. Карты вирусной инфекции хозяина показывают признаки тяжелых пациентов с COVID-19. Ячейка 181 , 1475–1488 e1412 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 9.

    Chua, R. L. et al. Тяжесть COVID-19 коррелирует с взаимодействиями эпителия дыхательных путей с иммунными клетками, выявленными с помощью одноклеточного анализа. Nat. Biotechnol. 38 , 970–979 (2020).

    CAS Статья Google Scholar

  • 10.

    Lee, J. S. et al. Иммунофенотипирование COVID-19 и гриппа подчеркивает роль интерферонов типа I в развитии тяжелой формы COVID-19. Sci. Иммунол . 5 , eabd1554 (2020).

  • 11.

    Schulte-Schrepping, J. et al. Тяжелая форма COVID-19 характеризуется нарушением регуляции миелоидных клеток. Ячейка 182 , 1419–1440.e1423 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 12.

    Ziegler, C.G.K. et al. Рецептор SARS-CoV-2 ACE2 представляет собой стимулируемый интерфероном ген в эпителиальных клетках дыхательных путей человека и обнаруживается в определенных подмножествах клеток в тканях. Ячейка 181 , 1016–1035.e1019 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 13.

    Liao, M. et al. Одноклеточный ландшафт бронхоальвеолярных иммунных клеток у пациентов с COVID-19. Nat. Med. 26 , 842–844 (2020).

    CAS Статья Google Scholar

  • 14.

    Wilk, A. J. et al.Одноклеточный атлас периферического иммунного ответа у пациентов с тяжелой формой COVID-19. Nat. Мед . https://doi.org/10.1038/s41591-020-0944-y (2020).

  • 15.

    Zheng, Z. et al. Факторы риска критических и смертельных случаев COVID-19: систематический обзор литературы и метаанализ. J. Инфекция https://doi.org/10.1016/j.jinf.2020.04.021 (2020).

  • 16.

    Singh, D. K. et al. Ответы на острую инфекцию SARS-CoV-2 в легких макак-резусов, павианов и мартышек. Nat. Микробиол . https://doi.org/10.1038/s41564-020-00841-4 (2020).

  • 17.

    Anders, S. & Huber, W. Анализ дифференциальной экспрессии для данных подсчета последовательностей. Genome Biol. 11 , R106 (2010).

    CAS PubMed PubMed Central Статья Google Scholar

  • 18.

    Fabregat, A. et al. База знаний по реактивным путям. Nucleic Acids Res. 46 , D649 – D655 (2018).

    CAS PubMed Статья PubMed Central Google Scholar

  • 19.

    Канехиса М., Сато Ю., Фурумичи М., Моришима К. и Танабе М. Новый подход к пониманию вариаций генома в KEGG. Nucleic Acids Res. 47 , D590 – D595 (2019).

    CAS PubMed Статья PubMed Central Google Scholar

  • 20.

    Онтология гена, К.Ресурсы по генной онтологии: 20 лет и все еще сильны. Nucleic Acids Res. 47 , D330 – D338 (2019).

    Артикул CAS Google Scholar

  • 21.

    Sakatsume, M. et al. Киназы Jak по-разному связываются с цепями альфа и бета (дополнительных факторов) рецептора гамма-интерферона с образованием функциональной рецепторной единицы, способной активировать факторы транскрипции STAT. J. Biol. Chem. 270 , 17528–17534 (1995).

    CAS PubMed Статья PubMed Central Google Scholar

  • 22.

    Агует М., Дембич З. и Мерлин Г. Молекулярное клонирование и экспрессия рецептора гамма-интерферона человека. Cell 55 , 273–280 (1988).

    CAS PubMed Статья PubMed Central Google Scholar

  • 23.

    Walter, M. R. et al. Кристаллическая структура комплекса между гамма-интерфероном и его растворимым высокоаффинным рецептором. Nature 376 , 230–235 (1995).

    CAS PubMed Статья PubMed Central Google Scholar

  • 24.

    Thiel, D. J. et al. Обнаружение неожиданной третьей рецепторной молекулы в кристаллической структуре человеческого интерферон-гамма-рецепторного комплекса. Структура 8 , 927–936 (2000).

    CAS PubMed Статья PubMed Central Google Scholar

  • 25.

    Олейник Дж., Хьюм А. Дж. И Мулбергер Е. Толл-подобный рецептор 4 при острой вирусной инфекции: слишком много хорошего. PLoS Pathog. 14 , e1007390 (2018).

    PubMed PubMed Central Статья CAS Google Scholar

  • 26.

    Wang, J. & Li, Y.CD36 tango при раке: сигнальные пути и функции. Тераностика 9 , 4893–4908 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 27.

    Оклинд Г., Фридрихс Д. и Петерс Дж. Х. Экспрессия CD54, CD58, CD14 и HLA-DR на макрофагах и дополнительных клетках, происходящих из макрофагов, и их вспомогательная способность. Immunol. Lett. 31 , 253–258 (1992).

    CAS PubMed Статья PubMed Central Google Scholar

  • 28.

    Moingeon, P. et al. CD2-опосредованная адгезия облегчает функцию распознавания антигена Т-лимфоцитами. Nature 339 , 312–314 (1989).

    CAS PubMed Статья PubMed Central Google Scholar

  • 29.

    Dengler, T. J. et al. Структурные и функциональные эпитопы рецептора адгезии человека CD58 (LFA-3). Eur. J. Immunol. 22 , 2809–2817 (1992).

    CAS PubMed Статья PubMed Central Google Scholar

  • 30.

    Дастин, М. Л., Селварадж, П., Матталиано, Р. Дж. И Спрингер, Т. А. Механизмы закрепления гликопротеина адгезии клеток LFA-3 на поверхности мембраны. Nature 329 , 846–848 (1987).

    CAS PubMed Статья PubMed Central Google Scholar

  • 31.

    Gollob, J. A. et al. Молекулярное взаимодействие между контррецепторами CD58 и CD2 опосредует способность моноцитов усиливать активацию Т-клеток IL-12. J. Immunol. 157 , 1886–1893 (1996).

    CAS PubMed PubMed Central Google Scholar

  • 32.

    Selvaraj, P. et al. Гликопротеин CD2 Т-лимфоцитов связывает лиганд клеточной поверхности LFA-3. Nature 326 , 400–403 (1987).

    CAS PubMed Статья PubMed Central Google Scholar

  • 33.

    Спрингер Т. А., Дастин М. Л., Кишимото Т. К. и Марлин С. Д. Связанные с функцией лимфоцитов молекулы LFA-1, CD2 и LFA-3: рецепторы клеточной адгезии иммунной системы. Annu. Rev. Immunol. 5 , 223–252 (1987).

    CAS PubMed Статья PubMed Central Google Scholar

  • 34.

    Rolle, A. et al. Взаимодействия CD2-CD58 имеют решающее значение для активации и функции адаптивных естественных клеток-киллеров при цитомегаловирусной инфекции человека. Eur. J. Immunol. 46 , 2420–2425 (2016).

    PubMed Статья CAS PubMed Central Google Scholar

  • 35.

    Leitner, J., Herndler-Brandstetter, D., Zlabinger, G.J., Grubeck-Loebenstein, B. & Steinberger, P. CD58 / CD2 является основным костимулирующим путем в CD28-CD8 + Т-клетках человека. J. Immunol. 195 , 477–487 (2015).

    CAS Статья Google Scholar

  • 36.

    Rafiq, K., Mori, H., Masaki, T. & Nishiyama, A. (Pro) рецептор ренина и инсулинорезистентность: возможные роли ангиотензин II-зависимых и независимых путей. Мол. Клетка. Эндокринол. 378 , 41–45 (2013).

    CAS PubMed Статья PubMed Central Google Scholar

  • 37.

    Schroder, A. K., Uciechowski, P., Fleischer, D. & Rink, L. Сшивание CD66B на нейтрофилах периферической крови опосредует высвобождение интерлейкина-8 из внутриклеточного хранилища. Hum. Иммунол. 67 , 676–682 (2006).

    PubMed Статья CAS PubMed Central Google Scholar

  • 38.

    Чернюк С. и др. Рецептор 2 формилпептида играет пагубную роль при инфицировании вирусом гриппа А. J. Infect. Дис. 214 , 237–247 (2016).

    CAS PubMed Статья PubMed Central Google Scholar

  • 39.

    Amat, M. et al. Эволюция лейкотриена B4, пептидных лейкотриенов и интерлейкина-8 в плазме крови у пациентов с риском острого респираторного дистресс-синдрома и с острым респираторным дистресс-синдромом: прогностическое исследование смертности. Крит. Care Med. 28 , 57–62 (2000).

    CAS PubMed Статья PubMed Central Google Scholar

  • 40.

    Saftig, P., Beertsen, W. & Eskelinen, E. L. LAMP-2: контрольный этап созревания фагосом и аутофагосом. Аутофагия 4 , 510–512 (2008).

    CAS PubMed Статья PubMed Central Google Scholar

  • 41.

    Wu, C. et al. Факторы риска, связанные с острым респираторным дистресс-синдромом и смертью пациентов с коронавирусной пневмонией 2019 года в Ухане, Китай. Внутренняя медицина JAMA . https://doi.org/10.1001/jamainternmed.2020.0994 (2020).

  • 42.

    Spagnolo, P. et al. Легочный фиброз, вызванный COVID-19: призыв к оружию? Ланцет Респир. Мед . https://doi.org/10.1016/S2213-2600(20)30222-8 (2020).

  • 43.

    Meduri, G.U. et al. Постоянное повышение воспалительных цитокинов предсказывает плохой исход при ОРДС. Уровни ИЛ-1 бета и ИЛ-6 в плазме являются последовательными и эффективными предикторами исхода с течением времени. Сундук 107 , 1062–1073 (1995).

    CAS PubMed Статья PubMed Central Google Scholar

  • 44.

    Бартрам, У. и Спир, С. П. Роль трансформирующего фактора роста бета в развитии легких и заболеваниях. Сундук 125 , 754–765 (2004).

    PubMed Статья PubMed Central Google Scholar

  • 45.

    Lambert, D. W. et al. Альфа-конвертаза фактора некроза опухоли (ADAM17) опосредует регулируемое выделение эктодомена рецептора коронавируса (SARS-CoV), ангиотензинпревращающего фермента-2 (ACE2) при тяжелом остром респираторном синдроме. J. Biol. Chem. 280 , 30113–30119 (2005).

    CAS PubMed Статья PubMed Central Google Scholar

  • 46.

    Steinbuck, M. P. & Winandy, S. Обзор обработки notch с новым пониманием лиганд-независимой передачи сигналов notch в Т-клетках. Фронт. Иммунол. 9 , 1230 (2018).

    PubMed PubMed Central Статья CAS Google Scholar

  • 47.

    Мерад, М. и Мартин, Дж. С. Патологическое воспаление у пациентов с COVID-19: ключевая роль моноцитов и макрофагов. Nat. Rev. Immunol. 20 , 355–362 (2020).

    CAS Статья Google Scholar

  • 48.

    Zhang, Q. et al. ACE2 подавляет ангиогенез рака груди путем подавления пути VEGFa / VEGFR2 / ERK. J. Exp. Clin. Cancer Res. 38 , 173 (2019).

    PubMed PubMed Central Статья Google Scholar

  • 49.

    Yu, X. et al. ACE2 противодействует VEGFa, снижая проницаемость сосудов во время острого повреждения легких. Cell. Physiol. Biochem. 38 , 1055–1062 (2016).

    CAS PubMed Статья PubMed Central Google Scholar

  • 50.

    Ahmed, M. et al. Иммунные корреляты туберкулеза и риска передаются у разных видов. Sci. Пер. Мед . https://doi.org/10.1126/scitranslmed.aay0233 (2020).

  • 51.

    Didangelos, A. Гипервоспаление, вызванное COVID-19: как насчет нейтрофилов? mSphere https://doi.org/10.1128/mSphere.00367-20 (2020).

  • 52.

    Кэмп, Дж. В. и Йонссон, К. Б. Роль нейтрофилов в вирусных респираторных заболеваниях. Фронт. Иммунол. 8 , 550 (2017).

    PubMed PubMed Central Статья CAS Google Scholar

  • 53.

    Zheng, M. et al. Функциональное истощение противовирусных лимфоцитов у пациентов с COVID-19. Cell. Мол. Иммунол. 17 , 533–535 (2020).

    CAS PubMed Статья PubMed Central Google Scholar

  • 54.

    Steinwede, K. et al. Катепсин G и эластаза нейтрофилов способствуют защитному иммунитету легких против микобактериальных инфекций у мышей. J. Immunol. 188 , 4476–4487 (2012).

    CAS PubMed Статья PubMed Central Google Scholar

  • 55.

    Son, E. D. et al. Катепсин G увеличивает экспрессию ММП в нормальных фибробластах человека за счет фрагментации фибронектина и индуцирует превращение проММП-1 в активную ММП-1. J. Dermatol. Sci. 53 , 150–152 (2009).

    CAS PubMed Статья PubMed Central Google Scholar

  • 56.

    Gao, S., Zhu, H., Zuo, X. & Luo, H. Катепсин G и его роль в воспалении и аутоиммунных заболеваниях. Arch. Ревматол. 33 , 498–504 (2018).

    PubMed PubMed Central Статья Google Scholar

  • 57.

    Morrissey, S. M. et al. Появление воспалительных нейтрофилов низкой плотности коррелирует с состоянием гиперкоагуляции и тяжестью заболевания у пациентов с COVID-19. Препринт на medRxiv https: // doi.org / 10.1101 / 2020.05.22.20106724 (2020).

  • 58.

    Silverstein, R. L. & Febbraio, M. CD36, рецептор скавенджера, участвующий в иммунитете, метаболизме, ангиогенезе и поведении. Sci. Сигнал 2 , re3 (2009).

    PubMed PubMed Central Статья CAS Google Scholar

  • 59.

    Ackermann, M. et al. Эндотелиит легочных сосудов, тромбоз и ангиогенез при Covid-19. N. Engl. J. Med. 383 , 120–128 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 60.

    Han, L. et al. Одноклеточный атлас приматов, кроме человека, раскрывает новые патогенетические механизмы COVID-19. bioRxiv https://doi.org/10.1101/2020.04.10.022103 (2020).

  • 61.

    Barnes, B.J. et al. Ориентация на потенциальные факторы COVID-19: внеклеточные ловушки нейтрофилов. J. Exp. Мед . https://doi.org/10.1084/jem.20200652 (2020).

  • 62.

    Кузнецова А., Брокхофф П. Б. и Кристенсен Р. Х. Б. lmerTest Package: тесты в линейных моделях со смешанными эффектами. J. Stat. Софтв. 82 , 1–26 (2017).

    Артикул Google Scholar

  • 63.

    Blanco-Melo, D. et al. Несбалансированная реакция хозяина на SARS-CoV-2 способствует развитию COVID-19. Ячейка 181 , 1036–1045.e1039 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 64.

    Cameron, M. J. et al. Опосредованные интерфероном иммунопатологические явления связаны с атипичными врожденными и адаптивными иммунными ответами у пациентов с тяжелым острым респираторным синдромом. J. Virol. 81 , 8692–8706 (2007).

    CAS PubMed PubMed Central Статья Google Scholar

  • 65.

    Zuo, W., Zhao, X. & Chen, Y.G. Коронавирус SARS и фиброз легких. Мол. Биол. SARS-коронавирус https://doi.org/10.1007/978-3-642-03683-5_15 (2009).

  • 66.

    Park, A. & Iwasaki, A. Интерфероны типа I и типа III — индукция, передача сигналов, уклонение и применение для борьбы с COVID-19. Клеточный микроб-хозяин 27 , 870–878 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 67.

    Блондоннет Р., Константин Дж. М., Сапин В. и Жабодон М. Патофизиологический подход к биомаркерам при остром респираторном дистресс-синдроме. Dis. Маркеры 2016 , 3501373 (2016).

    PubMed PubMed Central Статья CAS Google Scholar

  • 68.

    Перлман С. и Дандекар А. А. Иммунопатогенез коронавирусных инфекций: последствия для SARS. Nat. Rev. Immunol. 5 , 917–927 (2005).

    CAS PubMed PubMed Central Статья Google Scholar

  • 69.

    Джордж П. М., Уэллс А. У. и Дженкинс Р. Г. Легочный фиброз и COVID-19: потенциальная роль антифибротической терапии. Ланцет Респир. Мед . https://doi.org/10.1016/S2213-2600(20)30225-3 (2020).

  • 70.

    Tripathi, D. et al. Алкоголь увеличивает выработку интерферона-α типа 1 и повышает смертность молодых мышей, инфицированных Mycobacterium tuberculosis . PLOS Pathog. 14 , e1007174 (2018).

    PubMed PubMed Central Статья CAS Google Scholar

  • 71.

    Rizzo, P. et al. COVID-19 в сердце и легких: можем ли мы «перерезать» воспалительный шторм? Basic Res. Кардиол. 115 , 31 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 72.

    Cruickshank, M. N. & Ulgiati, D. Роль передачи сигналов notch в развитии нормального репертуара B-клеток. Immunol. Cell Biol. 88 , 117–124 (2010).

    CAS PubMed Статья PubMed Central Google Scholar

  • 73.

    Domeier, P. P. et al. Внутренняя передача сигналов интерферона типа 1 В-клеткам имеет решающее значение для потери толерантности и развития аутореактивных В-клеток. Cell Rep. 24 , 406–418 (2018).

    CAS PubMed PubMed Central Статья Google Scholar

  • 74.

    Кифер К., Оропалло М. А., Канкро М. П. и Маршак-Ротштейн А. Роль интерферонов типа I в активации аутореактивных В-клеток. Immunol. Cell Biol. 90 , 498–504 (2012).

    CAS PubMed PubMed Central Статья Google Scholar

  • 75.

    Vasconcellos, R., Braun, D., Coutinho, A. & Demengeot, J. IFN типа I устанавливает строгость отбора репертуара B-клеток в костном мозге. Внутр. Иммунол. 11 , 279–288 (1999).

    CAS PubMed Статья PubMed Central Google Scholar

  • 76.

    Costela-Ruiz, VJ, Illescas-Montes, R., Puerta-Puerta, JM, Ruiz, C. & Melguizo-Rodriguez, L. Инфекция SARS-CoV-2: роль цитокинов в COVID- 19 болезнь. Фактор роста цитокинов Ред. . https://doi.org/10.1016/j.cytogfr.2020.06.001 (2020).

  • 77.

    Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: гибкий триммер для данных последовательности Illumina. Биоинформатика 30 , 2114–2120 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 78.

    Yates, A. D. et al. Ensembl 2020. Nucleic Acids Res. 48 , D682 – D688 (2020).

    CAS Статья Google Scholar

  • 79.

    Dobin, A. et al. STAR: сверхбыстрый универсальный выравниватель RNA-seq. Биоинформатика 29 , 15–21 (2013).

    CAS PubMed PubMed Central Статья Google Scholar

  • 80.

    Leinonen, R., Sugawara, H. & Shumway, M., от имени Международной базы данных нуклеотидных последовательностей, C.Архив чтения последовательности. Nucleic Acids Res. 39 , D19 – D21 (2011).

    CAS PubMed Статья PubMed Central Google Scholar

  • 81.

    Liao, Y., Smyth, G. K. & Shi, W. featureCounts: эффективная программа общего назначения для сопоставления считываний последовательностей с геномными особенностями. Биоинформатика 30 , 923–930 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 82.

    Бенджамини Ю. и Хохберг Ю. Контроль уровня ложных открытий: практичный и эффективный подход к множественному тестированию. J. R. Stat. Soc. Сер. B Стат. Методол. 57 , 289–300 (1995).

    Google Scholar

  • 83.

    Wang, J., Vasaikar, S., Shi, Z., Greer, M. & Zhang, B. WebGestalt 2017: более всеобъемлющий, мощный, гибкий и интерактивный инструментарий для анализа обогащения набора генов. Nucleic Acids Res. 45 , W130 – W137 (2017).

    CAS PubMed PubMed Central Статья Google Scholar

  • 84.

    Raudvere, U. et al. g: Profiler: веб-сервер для функционального анализа обогащения и преобразования списков генов (обновление 2019 г.). Nucleic Acids Res. 47 , W191 – W198 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • Кристиан Шиндлер, Мэриленд | Программа MD-PhD Медицинского центра Колумбийского университета

    Публикации

    Фарлик, М., Reutterer, B., Schindler, C., Greten, F., Vogl, C., Muller, M. и Decker, T. (2010) Нетрадиционная сборка комплекса инициации с помощью факторов транскрипции STAT и NF-kappaB регулирует экспрессию синтазы оксида азота . Иммунитет 33: 25-34.

    Melillo, JA, Song, L., Bhagat, G., Blazquez, AB, Plumlee, CR, Lee, C., Berin, C., Reizis, B. и Schindler, C. (2010) Дендритная клетка (DC ) -специфическое нацеливание показывает, что Stat3 является негативным регулятором функции постоянного тока. J. Immunol. 184: 2638-2645.

    Пламли, К.Р., Ли, К., Бег, А.А., Деккер, Т., Шуман, Х.А. и Schindler, C. (2009). Интерфероны направляют эффективный врожденный ответ на инфекцию Legionella pneumophila. J. Biol. Chem. 284: 30058-30066.

    Martin, FJ, Gomez, IM, Wetzel, M., Memmi, G., O’Seaghdha, M., Soong G., Schindler, C. и Prince, A. (2009) S. aureus активирует IFN типа I. передача сигналов через повторяющиеся последовательности Xr белка AJ Clin. Вкладывать деньги. 115: 1931-1939.

    Чжао, В., Ли, К., Пиганис, Р., Пламли, К., de Weerd, N., Hertzog, P.J. and Schindler, C. (2008) Консервативный тирозиновый мотив рецептора IFN-альфа направляет биологический ответ на IFN типа I. J. Immunol. 180: 5483-5489.

    Schindler, C. и Plumlee, C. (2008) IFN-представляет собой путь JAK-STAT. Сем. Cell Dev. Биол. 19: 311-318.

    Zhao, W., Cha, E.N., Lee, C., Park, C.Y. и Schindler, C. (2007) Stat2-зависимая регуляция экспрессии MHC класса II. J. Immunol. 179: 463-471.

    Шиндлер, К., Леви, Д.Э. и Декер Т. (2007) Передача сигналов JAK-STAT: от интерферонов к цитокинам. J. Biol. Chem. 282: 20059-20063.

    Киселева, Т., Сонг, Л., Ворончихина, М., Фейрт, Н., Китаевски, Дж. И Шиндлер, К. (2006) Регулирование функции эндотелиальных клеток NFkB во время токсемии ЛПС и рака. J. Clin. Вкладывать деньги. 116: 2955-2953.

    Сонг, Л., Баттачарья, С., Юнис, А.А., Лима, К.Д. и Шиндлер К. (2006) Модификация SUMO Stat1. Кровь 108: 3237-3244.

    Песня, Л., Leung, C. и Schindler, C. (2001) Лимфоциты играют важную роль в развитии атеросклероза. J. Clin. Вкладывать деньги. 108: 251-259.

    Park, C., Li, S., Cha, E. and Schindler, C. (2000) Иммунный ответ у мышей, нокаутированных по Stat2. Иммунитет 13: 795-804.

    Azam, M., Lee, C., Strehlow, I. и Schindler, C. (1997) Функциональные отдельные изоформы Stat5 генерируются процессингом белка. Иммунитет 6: 691-701.

    Гупта, С., Пабло, А.М., Цзян, X-c., Ван, Н., Талл. А. и Шиндлер К.(1997) IFN-гамма усиливает атеросклероз у мышей с нокаутом по ароЕ. J. Clin. Вкладывать деньги. 99: 2752-2761.

    Schindler, C., Shuai, K., Prezioso, V. и Darnell, J.E. (1992) Интерферон-зависимое фосфорилирование тирозина латентного цитоплазматического фактора транскрипции. Наука 257: 809-813.

    Регулирование совместным составом IFN-α / IFN-γ (HerberPAG®) генов, участвующих в путях интерферона-STAT и апоптозе в U87MG

    Название: Регламент IFN — & # 945; / IFN — & # 947; Совместное формирование (HerberPAG ® ) генов, участвующих в путях интерферона-STAT и апоптоза в U87MG

    ОБЪЕМ: 14 ВЫПУСК: 3

    Автор (ы): Клаудиа Белло, Дания Васкес-Бломквист, Джамилет Миранда, Янельда Гарсия, Лидия Инес Новоа, Даниэль Паленсуэла и Иральдо Белло

    Место работы: Отделение геномики Центра генной инженерии и биотехнологии.Ave. 31 e / 158 & 190, Playa, 10600 Гавана, Куба.

    Ключевые слова: Интерфероны, herberPAG ® , антипролифератив, мультиформная глиобластома, фармакогеномика.

    Реферат: Интерфероны (ИФН) — белки семейства цитокинов. Их антипролиферативная функция была принята во внимание. приходится несколько клинических методов лечения злокачественных заболеваний. В этом семействе IFN α и γ продемонстрировали самый высокий уровень противоопухолевые эффекты.HerberPAG ® — это новый совместный препарат с IFN, α2b и γ. Было получено увеличение антипролиферативного действия. действие отдельных ИФН и снижение связанной с ними токсичности. Мультиформная глиобластома (ГБМ) — это самая распространенная первичная опухоль головного мозга и одна из самых смертельных форм рака. Целью данной работы является получить представление о регуляции интерферон-STAT-путей и апоптоза в U87MG на уровне транскрипции. В виде В рамках фармакогеномной стратегии мы количественно определили уровни мРНК in vitro с помощью количественной ПЦР, используя клеточную линию U87MG в качестве модель.Некоторые из генов, участвующих в первых этапах сигнальных путей IFN (stat1 и stat3) и событиях апоптоза (tp53, bax, bcl-2, bad, каспаза3 (casp3), каспаза8 (casp8) и каспаза9 (casp9)).

    alexxlab

    Related Posts

    Добавить комментарий

    Ваш адрес email не будет опубликован.